Peter K. Law

Angiomyogenesis for cardiac repair using human myoblasts as carriers of human vascular endothelial growth factor

This study investigated the potential of human skeletal myoblast carrying human VEGF165 for angiomyogenesis for cardiac repair. A porcine heart model of chronic infarction was created in 18 female swine by coronary artery ligation. The animals were randomized into: group 1, DMEM injected (n=6), group 2, myoblast transplanted (n=5) and group 3, VEGF165 myoblast transplanted (n=7). Three weeks later 5xa0ml DMEM containing 3×108 myoblast carrying exogenous genes were injected into 20 sites in left ventricle intramyocardially in groups 2 and 3. Group 1 animals were injected 5xa0ml DMEM without cells. Animals were kept on 5xa0mg/kg cyclosporine per day for 6xa0weeks. Regional blood flow was measured using fluorescent microspheres. The heart was explanted between 6–12xa0weeks after transplantation for histological studies. Histological examination showed survival of lac-z expressing myoblasts in host tissue. Capillary density at low power field (×100) was 57.13±4.20 in group 3 which was significantly higher than the other groups. Regional blood flow was significantly improved 6 and 12xa0weeks after transplantation, which was 2.41±0.11 and 3.39±0.11xa0ml−1xa0min−1xa0g−1), respectively, in group 3. Left ventricular ejection fraction increased from 31.25±4.09% to 43.0±2.68% at 6xa0weeks in group 3. Human myoblasts are potential transgene carriers for the myocardium, in addition to strengthening the weakened myocardium through myogenesis.

Transplantation of Nanoparticle Transfected Skeletal Myoblasts Overexpressing Vascular Endothelial Growth Factor-165 for Cardiac Repair

Background— We investigated the feasibility and efficacy of polyethylenimine (PEI) based human vascular endothelial growth factor-165 (hVEGF165) gene transfer into human skeletal myoblasts (HSM) for cell based delivery to the infarcted myocardium. Methods and Results— Based on optimized transfection procedure using enhanced green fluorescent protein (pEGFP), HSM were transfected with plasmid-hVEGF165 (phVEGF165) carried by PEI (PEI- phVEGF165) nanoparticles. The transfected HSM were characterized for transfection and expression of hVEGF165 in vitro and transplanted into rat heart model of acute myocardial infarction (AMI): group-1=DMEM injection, group-2= HSM transplantation, group-3= PEI-phVEGF165–transfected HSM (PEI-phVEGF165 myoblast) transplantation. A total of 48 rats received cyclosporine injection from 3 days before and until 4 weeks after cell transplantation. Echocardiography was performed to assess the heart function. Animals were sacrificed for molecular and histological studies on the heart tissue at 4 weeks after treatment. Based on optimized transfection conditions, transfected HSM expressed hVEGF165 for 18 days with >90% cell viability in vitro. Apoptotic index was reduced in group-2 and group-3 as compared with group-1. Blood vessel density (×400) by immunostaining for PECAM-1 in group-3 was significantly higher (P=0.043 for both) as compared with group-1 and group-2 at 4 weeks. Regional blood flow (ml/min/g) in the left ventricular anterior wall was higher in group-3 (P=0.043 for both) as compared with group-1 and group-2. Improved ejection fraction was achieved in group-3 (58.44±4.92%) as compared with group-1 (P=0.004). Conclusion— PEI nanoparticle mediated hVEGF165 gene transfer into HSM is feasible and safe. It may serve as a novel and efficient alternative for angiomyogenesis in cardiac repair.

Improved angiogenic response in pig heart following ischaemic injury using human skeletal myoblast simultaneously expressing VEGF165 and angiopoietin-1.

To achieve angiogenic interaction between VEGF165 and angiopoietin‐1 (Ang‐1) using a novel adenoviral bicistronic vector (Ad‐Bic) encoding the two factors and delivered ex vivo using sex‐mismatched human skeletal myoblasts.

Angiomyogenesis using liposome based vascular endothelial growth factor-165 transfection with skeletal myoblast for cardiac repair

We aim to investigate the feasibility and efficacy of cholesterol (Chol)+DOTAP liposome (CD liposome) based human vascular endothelial growth factor-165 (hVEGF(165)) gene transfer into human skeletal myoblasts (hSkM) for cardiac repair. The feasibility and efficacy of CD liposome for gene transfer with hSkM was characterized using plasmid carrying enhanced green fluorescent protein (pEGFP). Based on the optimized transfection procedure, hSkM were transfected with CD lipoplexes carrying plasmid-hVEGF(165) (CD-phVEGF(165)). The genetically modified hSkM were transplanted into rat heart model of acute myocardial infarction. Flow cytometry revealed that about 7.99% hSkM could be transfected with pEGFP. Based on the optimized transfection condition, transfected hSkM expressed hVEGF(165) up to day-18 (1.7+/-0.1ng/ml) with peak at day-2 (13.1+/-0.52ng/ml) with >85% cell viability. Animal studies revealed that reduced apoptosis, improved angiogenesis with blood flow in group-3 animals heart were achieved as compared to group-1 and 2. Ejection fraction was best recovered in group-3 animals. The study demonstrates that though gene transfection efficiency using CD liposome mediated hVEGF(165) gene transfer with hSkM was low; hVEGF(165) gene expression efficiency was sufficient to induce neovascularization, improve blood flow and injured heart function.

Reversal of myocardial injury using genetically modulated human skeletal myoblasts in a rodent cryoinjured heart model

We hypothesized that combination therapy using human myoblasts and VEGF165 will lead to better prognosis in a failing heart.

Nonviral Vector-Based Gene Transfection of Primary Human Skeletal Myoblasts

Low-level transgene efficiency is one of the main obstacles in ex vivo nonviral vector–mediated gene transfer into primary human skeletal myoblasts (hSkMs). We optimized the cholesterol:N-[1-(2, 3-dioleoyloxy)propyl]-N, N, N-trimethylammonium methylsulfate liposome (CD liposome) and 22-kDa polyethylenimine (PEI22)– and 25-kDa polyethylenimine (PEI25)–mediated transfection of primary hSkMs for angiogenic gene delivery. We found that transfection efficiency and cell viability of three nonviral vectors were cell passage dependent: early cell passages of hSkMs had higher transfection efficiencies with poor cell viabilities, whereas later cell passages of hSkMs had lower transfection efficiencies with better cell viabilities. Trypsinization improved the transfection efficiency by 20% to 60% compared with adherent hSkMs. Optimum gene transfection efficiency was found with passage 6 trypsinized hSkMs: transfection efficiency with CD lipoplexes was 6.99 ± 0.13%, PEI22 polyplexes was 18.58 ± 1.57%, and PEI25 polyplexes was 13.32 ± 0.88%. When pEGFP (a plasmid encoding the enhanced green fluorescent protein) was replaced with a vector containing human vascular endothelial growth factor 165 (phVEGF165), the optimized gene transfection conditions resulted in hVEGF165 expression up to Day 18 with a peak level at Day 2 after transfection. This study demonstrated that therapeutic angiogenic gene transfer through CD or PEI is feasible and safe after optimization. It could be a potential strategy for treatment of

Human VEGF165-myoblasts produce concomitant angiogenesis/myogenesis in the regenerative heart

Bioengineering the regenerative heart may provide a novel treatment for heart failure. On May 14, 2002, a 55-year-old man suffering from ischemic myocardial infarction received 25 injections carrying 465 million cGMP-produced pure myoblasts into his myocardium after coronary artery bypass grafting. As on August 28, 2002, his EKG was normal and showed no arrhythmia. His ejection fraction increased by 13%. He no longer experienced shortness of breath and angina as he did before the treatment. Three myogenesis mechanisms were elucidated with 17 human/porcine xenografts using cyclosporine as immunosuppressant. Some myoblasts developed to become cardiomyocytes. Others transferred their nuclei into host cardiomyocytes through natural cell fusion. As yet others formed skeletal myofibers with satellite cells. De novo production of contractile filaments augmented the heart contractility. Human myoblasts transduced with VEGF165 gene produced six times more capillaries in porcine myocardium than in placebo. Xenograft rejection was not observed for up to 20 weeks despite cyclosporine discontinuation at 6 weeks. Pros and cons of autografts vs. allografts are compared to guide future development of heart cell therapy. (Mol Cell Biochem 263: 173–178, 2004)

High efficiency transduction of human VEGF 165 into human skeletal myoblasts: in vitro studies

We report the transduction of human VEGF165 gene into human myoblast and characterization of the transduced myoblasts for transduction and expression efficiency. Human myoblasts were assessed by immunostaining for desmin expression. A replication incompetent adenoviral vector carrying human VEGF165 was constructed and used for transduction of myoblasts. Immunostaining of transduced myoblasts was used to determine transduction efficiency. Expression efficiency was confirmed by immunoblotting, ELISA and reverse transcription (RT)-PCR analysis using human VEGF165 specific primers (5-3 = 5ATGAACTTTCTGCTGTCTTGGGTG and 3-5 = ACACCGCCTCGGCTTGTCACA3. Biological activity of the secreted VEGF165 was determined by human umbilical vein endothelial cell proliferation and [H3] thymidine incorporation assays. Human myoblast preparation was >95% pure with 99% viability after transduction. Immunostaining showed >95% VEGF165 positive myoblasts. Western blotting and ELISA revealed high VEGF165 expression in the transduced myoblasts. Maximum transduction efficiency was achieved by 8 h exposure of myoblasts to virus at 1:1,000 ratio on three consecutive days. Concentration of VEGF165 released in the culture medium peaked (37±3 ng/ml) at 8 days post-transduction. Cell proliferation assay on human umbilical vein endothelial cells using supernatant from VEGF165 transduced myoblasts revealed extensive proliferation of cells which was suppressed in the presence of anti-human VEGF165 antibody in culture medium and was further confirmed by thymidine incorporation assay. The untransduced myoblasts secreted VEGF165 in vitro (300±50 pg/ml) that is enhanced many folds (37±3 ng/ml) in VEGF165 transduced myoblast as determined by ELISA. These studies suggest that human myoblast are potential carriers of human VEGF165 to achieve concurrent angiomyogenesis for cardiac repair.

Liposome-based vascular endothelial growth factor-165 transfection with skeletal myoblast for treatment of ischaemic limb disease

The study aims to use cholesterol (Chol) + DOTAP liposome (CD liposome) based human vascular endothelial growth factor‐165 (VEGF165) gene transfer into skeletal myoblasts (SkMs) for treatment of acute hind limb ischaemia in a rabbit model. The feasibility and efficacy of CD liposome mediated gene transfer with rabbit SkMs were characterized using plasmid carrying enhanced green fluorescent protein (pEGFP) and assessed by flow cytometry. After optimization, SkMs were transfected with CD lipoplexes carrying plasmid‐VEGF165 (CD‐pVEGF165) and transplanted into rabbit ischaemic limb. Animals were randomized to receive intramuscular injection of Medium199 (M199; group 1), non‐transfected SkM (group 2) or CD‐pVEGF165 transfected SkM (group 3). Flow cytometry revealed that up to 16% rabbit SkMs were successfully transfected with pEGFP. Based on the optimized transfection condition, transfected rabbit SkM expressed VEGF165 up to day 18 with peak at day 2. SkMs were observed in all cell‐transplanted groups, as visualized with 6‐diamidino‐2‐phenylindole and bromodeoxyuridine. Angiographic blood vessel score revealed increased collateral vessel development in group 3 (39.7 ± 2.0) compared with group 2 (21.6 ± 1.1%, P < 0.001) and group 1 (16.9 ± 1.1%, P < 0.001). Immunostaining for CD31 showed significantly increased capillary density in group 3 (14.88 ± 0.9) compared with group 2 (8.5 ± 0.49, P < 0.001) and group 1 (5.69 ± 0.3, P < 0.001). Improved blood flow (ml/min./g) was achieved in animal group 3 (0.173 ± 0.04) as compared with animal group 2 (0.122 ± 0.016; P= 0.047) and group 1 (0.062 ± 0.012; P < 0.001). In conclusion, CD liposome mediated VEGF165 gene transfer with SkMs effectively induced neovascularization in the ischaemic hind limb and may serve as a safe and new therapeutic modality for the repair of acute ischaemic limb disease.

Skeletal myoblast transplantation on gene expression profiles of insulin signaling pathway and mitochondrial biogenesis and function in skeletal muscle

AIMnThe study aims to investigate the gene expression profiling of insulin signaling pathway and mitochondrial biogenesis and function in the skeletal muscle of KK mice.nnnMETHODSnKK mice were divided into the following groups: KK control group, basal medium (M199) only; KK fibroblast group, with human fibroblast transplantation; KK myoblast group, with human skeletal myoblast transplantation. C57BL mice received hSkM transplantation as a normal control. Cells were transplanted into mice hind limb skeletal muscle. All animals were treated with cyclosporine for 6 weeks only. The mice were sacrificed in a fasting state at 12 weeks after treatment. Hind limb skeletal muscle was harvested and used for study of gene expression profiling.nnnRESULTSnhSkMs survived extensively in mice skeletal muscle at 12 weeks after cell transplantation. Glucose tolerance test showed a significant decrease of blood glucose in the mice of KK myoblast group compared to the KK control and fibroblast groups. Transcriptional patterns of insulin signaling pathway showed alterations in KK myoblast as compared with KK control group (23 genes), KK fibroblast group (7 genes), and C57BL group (8 genes). Transcriptional patterns of mitochondrial biogenesis and function also had alterations in KK myoblast as compared with KK control group (27 genes), KK fibroblast group (9 genes), and C57BL group (6 genes).nnnCONCLUSIONSnThese data demonstrated for the first time that hSKM transplantation resulted in a change of gene transcript in multiple genes involved in insulin signaling pathway and mitochondrial biogenesis and function.