Peter Trillenberg

Neurophysiology and neuroanatomy of smooth pursuit in humans.

Smooth pursuit eye movements enable us to focus our eyes on moving objects by utilizing well-established mechanisms of visual motion processing, sensorimotor transformation and cognition. Novel smooth pursuit tasks and quantitative measurement techniques can help unravel the different smooth pursuit components and complex neural systems involved in its control. The maintenance of smooth pursuit is driven by a combination of the prediction of target velocity and visual feedback about performance quality, thus a combination of retinal and extraretinal information that has to be integrated in various networks. Different models of smooth pursuit with specific in- and output parameters have been developed for a better understanding of the underlying neurophysiological mechanisms and to make quantitative predictions that can be tested in experiments. Functional brain imaging and neurophysiological studies have defined motion sensitive visual area V5, frontal (FEF) and supplementary (SEF) eye fields as core cortical smooth pursuit regions. In addition, a dense neural network is involved in the adjustment of an optimal smooth pursuit response by integrating also extraretinal information. These networks facilitate interaction of the smooth pursuit system with multiple other visual and non-visual sensorimotor systems on the cortical and subcortical level. Future studies with fMRI advanced techniques (e.g., event-related fMRI) promise to provide an insight into how smooth pursuit eye movements are linked to specific brain activation. Applying this approach to neurological and also mental illness can reveal distinct disturbances within neural networks being present in these disorders and also the impact of medication on this circuitry.

Reduced intracortical facilitation in patients with cerebellar degeneration.

Objectives ‐ Transcranial magnetic stimulation (TMS) was used to study intracortical inhibitory and excitatory phenomena in patients with cerebellar ataxia. Methods ‐ Motor evoked potentials (MEP) following single and paired TMS were recorded from the first dorsal interosseus muscle (FDI) in 15 patients with autosomal‐dominant or idiopathic cerebellar ataxia and 15 age matched normal controls. Results‐ MEP amplitudes after paired TMS with short interstimulus intervals (1‐4 ms) showing intracortical inhibition in the control group were not significantly different in the patient group. In contrast, with longer interstimulus intervals (8‐20 ms) mean MEP amplitudes were significantly reduced in the patient group, indicating a decrease of intracortical facilitation. The mean postexcitatory inhibition after TMS was also significantly prolonged in the patient group. Conclusion‐Our findings support the idea that the cerebellum physiologically exerts a facilitatory influence on the motor cortex which is decreased in patients with a cerebellar degeneration.

Posterior and anterior contribution of hand-movement preparation to late CNV.

The late part of the Contingent Negative Variation (CNV) is assumed to be a composite potential, reflecting both movement preparation and several other processes. To assess the contribution of hand–motor preparation to overall CNV, 3 S1–S2 experiments were performed. Replicating earlier results that have been interpreted as demonstrating hand–motor preparation, Exp 1 showed that CNV gets larger centro–parietally under speed instruction. Exps 2 and 3 compared preparation for hand responses to preparation for ocular responses varying the effector system either between blocks (Exp 2) or between trials (Exp 3) and also comparing these preparation situations to no preparation (Exp 3). Ss consisted of 10 medical students aged 23–29 yrs in Exp 1, 12 Ss aged 23–31 yrs in Exp 2, and 11 Ss in Exp 3. Hand–motor preparation was reflected in CNV getting larger fronto–centrally, with this topography being different from the effect in Exp1. Thus, 2 different kinds of motor preparation appear to be reflected by CNV. One kind may consist of assembling and maintaining the stimulus–response links appropriate to the expected S2 patterns, the other is for activating the hand–motor area. These 2 motor contributions to CNV might reflect the 2 aspects of the parieto–frontal motor system.

Eye movements and psychiatric disease.

Purpose of reviewDuring the past year a number of studies have been published on eye movement dysfunction in patients with psychiatric disease. According to the mainstream of modern neuropsychiatric research, these studies cover either genetic aspects or the results of pharmacological manipulation. Recent findingsA few studies addressed impaired smooth pursuit eye movements (eye tracking dysfunction) in unaffected relatives of psychiatric patients, and were important in excluding non-specific effects (e.g. medication) and isolating genetic predisposition to the disease. This predisposition could be demonstrated in families of schizophrenic patients irrespective of whether the index case was sporadic or familial. One large study demonstrated pathological distributions of various parameters of smooth pursuit eye movement performance in groups of schizophrenic patients and their relatives. However, another study challenged the specificity of eye tracking dysfunction as a trait marker for schizophrenia by showing that its prevalence was identical among relatives of patients with affective disorder and schizophrenia. Eye tracking dysfunction was associated with two gene polymorphisms that interfere with dopamine metabolism and are thus reasonable candidate genes for the predisposition to schizophrenia. The influence of nicotine and neuroleptic drugs on eye movement performance was studied in schizophrenic patients. Nicotine improved smooth pursuit performance in three studies, one of which attributed this finding to enhanced attention. Two groups of schizophrenic patients treated with two different atypical neuroleptic drugs, risperidone and olanzapine, did not differ in a battery of saccadic tasks. SummaryEye movements provide an important tool to measure pharmacological effects in patients and unravel genetic traits in psychiatric disease.

Eye-hand coordination in essential tremor.

Patients with essential tremor (ET) or with cerebellar lesions have in common oculomotor abnormalities, with the exception of saccadic eye movements, which do not seem to be involved in ET. Since grasping is prolonged in ET and might be related to saccadic dysmetria, we tested whether simultaneous hand pointing could unmask it. Twelve ET patients and 14 controls performed saccades with and without simultaneous pointing movements to the same targets, and with and without a gap between the disappearance of the fixation point and the appearance of the target. Eye movements were recorded with the magnetic search‐coil method, hand movements with an ultrasound‐emitting probe. ET patients did not have saccadic dysmetria, and contrary to normal subjects their saccadic latency did not decrease during combined eye–hand movements compared with saccades performed in isolation. Hand movements had a longer duration in ET patients, with decreased peak acceleration, an increased latency of the peak velocity, and peak deceleration. In conclusion, this first study on eye–hand coordination in ET revealed abnormal kinematic changes in the early phase of pointing movements. These changes might be related to cerebellar disease but they are independent of the intention tremor component and saccade performance.

Effect of high‐dose methylprednisolone administration on immune functions in multiple sclerosis patients

Objectives – To investigate the in vivo effect of corticosteroid pulse therapy on immunocompetent cells in 18 patients given methylprednisolone to treat an acute episode of MS. Material and methods – Blood was sampled before and after 3 days of methylprednisolone administration at doses of 1 g/day. Lymphocyte subtyping was performed and whole blood cell cultures were used to measure the cytokine producing capacity for interleukin‐1 (IL‐1), interleukin‐2 (IL‐2), interferon‐γ (IFN‐γ), tumor necrosis factor‐a (TNF‐α) and interferon‐α (IFN‐α). In addition, serum levels of the immunoglobulin classes IgG, IgA and IgM were determined. Results – Before treatment, production of IL‐1 was significantly increased in MS patients as compared to healthy controls. After therapy, production of all cytokines was significantly decreased, whereas there were significant increases in the numbers of monocytes, neutrophils and T and B lymphocytes. Treatment had no effect on serum immunoglobulin levels. Conclusion – An important mechanism for the antiinflammatory effect of corticosteroids in MS results from a suppression of the activation of the peripheral immune compartment through inhibition of cytokine production and lymphocyte endothelial adhesiveness.

The p.P56S mutation in the VAPB gene is not due to a single founder: the first European case

To the Editor: A dominant missense mutation p.P56S in the vesicle associated membrane protein associated protein B (VAPB) gene was described in eight Brazilian families of Portuguese descent showing a wide spectrum of motor neuron diseases (MNDs) including spinal muscular atrophy (SMA) and familial amyotrophic lateral sclerosis (ALS) (ALS8) (1, 2). Haplotype analysis indicated a common ancestor with a founding event 23 generations previously, when this ancestor was still living in Portugal (3). We report the first identification of the p.P56S mutation in the VAPB gene in a non-Brazilian patient. A 43-year-old man (III-1) showed slowly progressive muscular weakness for 2 years and a family history of autosomal dominant neuromuscular disease through at least three generations (Fig 1). The patients mother (II-1) suffered from slowly progressive muscular weakness over 30 years. No pyramidal tract signs had been observed. She was wheelchair bound 20 years after onset and died at the age of 67. The maternal grandfather (I-1) had a history of progressive muscular weakness, had died aged 57 and had six siblings. Three (I-5, I-6, I-7) suffered from muscular weakness. One cousin of the patients mother (II-2) was diagnosed with SMA. There was no family record of Portuguese or Brazilian ancestors in at least four previous generations. All family members originated from northern Germany. Fig. 1 Family tree. Family members who are deemed affected based upon family history are marked gray. It is not known if family members I-2, I-3, I-4, I-5, I-6, I-7, and II-2 are still alive. The index patient (III-1) showed paresis of the hip flexors and extensors (Medical Research Council (MRC) grade 4/5) and fasciculations in the proximal muscles of arms, legs on both sides. Deep tendon reflexes were normal except for absent Achilles tendon reflexes. There were no pyramidal tract signs. Needle electromyography showed fasciculations and signs of chronic denervation. Nerve conduction studies of tibial nerves revealed slightly reduced amplitudes on the left. Motor evoked potentials in both tibialis anterior muscles after magnetic stimulation of the motor cortex and the lumbar roots were normal. Genomic DNA of the index case was extracted from peripheral blood and amplified using primer pairs flanking all exons and exon/intron boundaries of the VAPB gene. Amplicons were purified and sequenced directly on an ABI PRISM 310 Genetic Analyzer (PE, Applied Biosystems). The p.P56S mutation was screened in 100 German healthy controls. Haplotype analysis was performed using microsatellite markers D20S100, D20S171 and D20S173 from the ABI Prism Linkage Mapping Set kit version 2 (Applied Biosystems, Foster City, CA) as reported previously (3). The forward 5′AAGACAAGCAAAACTAAAGAACTGC3′and reverse 5′TTCCCATTACCGGTTATCCA-3′ primers were used to amplify part of 3′ UTR sequence of the tubulin beta 1 (TUBB1) gene. A polymorphism in this region was used as intrafamilial marker. Polymerase chain reaction products were analyzed using a MegaBace 1000 DNA Sequencer (Amersham Bioscience, Little Chalfont, UK). DNA from the index patient was compared to three affected individuals from three different kindreds of the Brazilian families. Sequencing revealed a heterozygous p.P56S point mutation in exon 2 of the VAPB gene. This mutation was not present in 200 German control chromosomes. Haplotype analysis revealed that this patient had a different haplotype compared to the Brazilian families (Table 1). Table 1 Haplotype comparison of the German index patient and the patients from three different Brazilian families with the p.P56S vesicle associated membrane protein associated protein B (VAPB) gene mutationa The phenotype of our index case and his mother represented late onset SMA as observed in one-third of the Brazilian patients carrying the p.P56S VAPB mutation (1). Although we cannot entirely exclude the possibility of Brazilian or Portuguese ancestors, haplotype analysis showed that our patients mutation is not due to the same founder as in the reported Brazilian patients. Therefore, we assume that the p.P56S mutation happened in at least two independent events. Several studies failed to identify VAPB mutations in cohorts of patients with ALS (4–6)]. Mutations in the VAPB gene seem to be rare in familial MNDs. However, our case report demonstrates that the p.P56S mutation can be observed outside Brazil, and should be considered as a rare differential diagnosis in familial MNDs.

Evidence from increased anticipation of predictive saccades for a dysfunction of fronto-striatal circuits in obsessive-compulsive disorder.

In obsessive-compulsive disorder (OCD), a dysfunction of neuronal circuits involving prefrontal areas and the basal ganglia is discussed that implies specific oculomotor deficits. Performance during reflexive and predictive saccades, antisaccades and predictive smooth pursuit was compared between patients with OCD (n=22), patients with schizophrenia (n=21) and healthy subjects (n=24). Eye movements were recorded by infrared reflection oculography. In both patient groups, higher frequencies of anticipatory saccades with reduced amplitudes in the predictive saccade task were observed. Additionally, reduced smooth pursuit eye velocity and increased frequencies of saccadic intrusions during smooth pursuit as well as increased error rates in the antisaccade task were demonstrated for patients suffering from schizophrenia. Patients with OCD and schizophrenia revealed different patterns of oculomotor impairment: whereas increased anticipation of predictive saccades provides evidence for a dysfunction of the circuit between the frontal eye field and the basal ganglia in both groups, results from the antisaccade task imply additional deficits involving the dorsolateral prefrontal cortex in schizophrenic patients. Furthermore, the cortical network for smooth pursuit (especially the frontal eye field) is also assumed to be disturbed in schizophrenia.

Optimal coil orientation for transcranial magnetic stimulation.

We study the impact of coil orientation on the motor threshold (MT) and present an optimal coil orientation for stimulation of the foot. The result can be compared to results of models that predict this orientation from electrodynamic properties of the media in the skull and from orientations of cells, respectively. We used a robotized TMS system for precise coil placement and recorded motor-evoked potentials with surface electrodes on the abductor hallucis muscle of the right foot in 8 healthy control subjects. First, we performed a hot-spot search in standard (lateral) orientation and then rotated the coil in steps of 10° or 20°. At each step we estimated the MT. For navigated stimulation and for correlation with the underlying anatomy a structural MRI scan was obtained. Optimal coil orientation was 33.1±18.3° anteriorly in relation to the standard lateral orientation. In this orientation the threshold was 54±18% in units of maximum stimulator output. There was a significant difference of 8.0±5.9% between the MTs at optimal and at standard orientation. The optimal coil orientations were significantly correlated with the direction perpendicular to the postcentral gyrus (). Robotized TMS facilitates sufficiently precise coil positioning and orientation to study even small variations of the MT with coil orientation. The deviations from standard orientation are more closely matched by models based on field propagation in media than by models based on orientations of pyramidal cells.

Consequences of altered cerebellar input for the cortical regulation of motor coordination, as reflected in EEG potentials

Abstract The cerebellum is certainly involved in fine coordination of movements, but has no efferences of its own to the muscles. Thus, it can exert its influence only via other cerebral areas that have those efferences. This study investigated in patients with cerebellar atrophy how cortical motor areas are affected by dysfunction of the cerebellum. The main question was whether the patients’ slow cortical electroencephalogram (EEG) potentials during key-press preparation and execution would be generally altered or would be specifically altered when fine coordination was needed. In the coordination task, right- and left-hand keys had to be pressed simultaneously with different forces, under visual feedback. Control tasks were to press with both hands equally or with one hand only. The patients indeed had a performance deficit in the coordination task. Their cortical EEG potentials were already drastically reduced in the simple tasks, but were enhanced by the same amount as in healthy subjects when more coordination was needed. These results suggest that the cerebellum is not exclusively active in fine coordination, but is generally involved in any kind of preparatory and executive activity, whereas the motor cortex becomes more active with fine coordination. The role of the cerebellum might be to provide the motor cortex with information needed for coordinating movements. In cerebellar atrophy, this altered input may be sufficient for the motor cortex in controlling simple tasks, but not for complex ones.