Pimprapar Wongsrikeao

Antiviral restriction factor transgenesis in the domestic cat

Studies of the domestic cat have contributed to many scientific advances, including the present understanding of the mammalian cerebral cortex. A practical capability for cat transgenesis is needed to realize the distinctive potential of research on this neurobehaviorally complex, accessible species for advancing human and feline health. For example, humans and cats are afflicted with pandemic AIDS lentiviruses that are susceptible to species-specific restriction factors. Here we introduced genes encoding such a factor, rhesus macaque TRIMCyp, and eGFP, into the cat germline. The method establishes gamete-targeted transgenesis for the first time in a carnivore. We observed uniformly transgenic outcomes, widespread expression, no mosaicism and no F1 silencing. TRIMCyp transgenic cat lymphocytes resisted feline immunodeficiency virus replication. This capability to experimentally manipulate the genome of an AIDS-susceptible species can be used to test the potential of restriction factors for HIV gene therapy and to build models of other infectious and noninfectious diseases.

Relationship between DNA fragmentation and nuclear status of in vitro-matured porcine oocytes: role of cumulus cells

The present study was conducted to investigate the effects of the attachment of cumulus cells to oocytes and coculture with cumulus cells during maturation culture on the nuclear status and DNA fragmentation of porcine denuded oocytes (DOs). In the first experiment, cumulus cells were removed from cumulus-oocyte complexes (COCs) at 0, 8, 16, 24 or 32 h after the onset of maturation culture and the DOs were then cultured in their original droplets until 42 h of culture was reached. In the second experiment, all COCs were denuded before the onset of culture and the DOs were cocultured with their removed cumulus cells. The DOs were transferred into fresh medium at 0, 8, 16, 24 or 32 h after the onset of coculture with cumulus cells and then cultured until 42 h of culture was reached. After culture, DNA fragmentation and the nuclear status of oocytes were examined using the terminal deoxyribonucleotidyl transferase-mediated dUTP-digoxigenin nick end-labelling (TUNEL) method. When the DOs were returned to the same droplets after removal of the cumulus cells, the removal of the cumulus cells after 16 h of culture significantly decreased the proportion of oocytes remaining at the germinal vesicle (GV) stage. However, coculture treatment of DOs in the presence of their removed cumulus cells had no significant effects on the GV breakdown (GVBD) of oocytes. There were no significant differences in the proportion maturing to MII oocytes among the groups following removal of cumulus cells after the onset of maturation culture; however, DOs cocultured with cumulus cells until the end of maturation culture exhibited an increased maturation rate compared with DOs cocultured for 8 and 16 h. The total proportion of TUNEL-positive oocytes of oocytes remaining at the GV stage was higher than that of oocytes reaching other stages, irrespective of the removal of cumulus cells and coculture treatments. However, coculture for more than 16 h decreased the total proportion of TUNEL-positive oocytes. Our results indicate that the attachment of cumulus cells to oocytes may have a critical role for oocytes undergoing GVBD and that coculture with cumulus cells promotes the ability of oocytes to complete maturation. Moreover, coculture with cumulus cells may assist the oocyte to avoid undergoing DNA fragmentation.

Meiotic competence and DNA damage of porcine oocytes exposed to an elevated temperature

The present study was conducted to investigate the effects of the length of exposure to an elevated temperature (41 degrees C) on the meiotic competence and DNA damage of porcine oocytes. Oocytes were recovered from ovaries, loaded into straws, and then exposed at 41.0 or 38.5 degrees C (sham control) for 0, 0.5, 1.0, or 1.5h, followed by culture for 44 h. The proportion of oocytes reaching the metaphase II (MII) stage gradually decreased with increasing exposure time, irrespective of the exposure temperature. A higher proportion of oocytes stored at 38.5 degrees C reached MII (57-63%) than those exposed to 41 degrees C (14-29%; P<0.01). The proportion of total oocytes with DNA fragmentation gradually increased with increasing exposure time, irrespective of the exposure temperature. The proportion of DNA fragmentation in total oocytes exposed to 41 degrees C (37-57%) was higher (P<0.01) than that in total oocytes stored at 38.5 degrees C (14-24%). When the oocytes were stored at 38.5 degrees C for up to 1.5 h, there were no differences in the proportions of MII-stage oocytes, with DNA-fragmented nuclei among all groups (P>0.05). However, a higher proportion of MII-stage oocytes exposed to 41 degrees C for more than 1h exhibited DNA-fragmented nuclei, compared with MII-stage oocytes stored at 38.5 degrees C (P<0.05). In conclusion, exposure of porcine oocytes to an elevated temperature had a detrimental effect on the meiotic competence and quality of oocytes; furthermore, the effect was dependent on the duration of exposure.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

BackgroundSince prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs.ResultsFour siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting.ConclusionFour siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Combination of the somatic cell nuclear transfer method and RNAi technology for the production of a prion gene-knockdown calf using plasmid vectors harboring the U6 or tRNA promoter

By combining RNAi technology with SCNT method, we attempted to produce transgenic calves with knocked down bPRNP for technological assessments. The respective utilities of type II (tRNA) and type III (hU6) Pol III promoters in mediating plasmid vector-based RNAi for the production of a bPRNP-knockdown calf were compared. Plasmid harboring DNA for siRNA expression was introduced stably into the genome of primary cultured bovine cells. By inserting the transgenic cell into an enucleated bovine egg, SCNT embryos were produced. The ability for SCNT embryos to develop to blastocysts was higher in hU6 based vector groups (44–53%) than in a tRNA group (32%). In all, 30 hU6-embryos and 12 tRNA-embryos were transferred to 11 recipients. Only tRNA-embryos were able to impregnate recipients (6 out of 11 transfers), resulting in four aborted fetuses, one stillbirth, and one live-born calf. The expression of EGFP, a marker, was detected in all six. The bPRNP transcript levels in the nervous tissues (brain, cerebellum, spinal bulb, and spinal cord) from the calf, which was killed 20 days after birth, were reduced to 35% of those of the control calf on average, as determined by qRT-PCR. The PrPC levels, as estimated by western blot were reduced to 86% on average in the nervous tissues. These findings suggest that SCNT technology remains immature, that the tRNA promoter is useful, and that RNAi can significantly reduce PRNP mRNA levels, but insufficient reduction of PrPC levels exists in cattle under these conditions.

Effects of the Reproductive Status on Morphological Oocyte Quality and Developmental Competence of Oocytes after In Vitro Fertilization and Somatic Cell Nuclear Transfer in Cat

This study was conducted to examine the effects of the reproductive cycle of donor cat on the quality of oocytes at recovery and developmental competence of oocytes after in vitro fertilization (IVF) and somatic cell nuclear transfer (NT). Based on the presence or absence of follicles and corpora lutea, the ovarian pairs collected were classified into inactive, follicular or luteal stages. After collection of oocytes, the oocytes were classified into four grades according to the morphological condition of oocyte cytoplasm and cumulus cells. A total of 16 558 oocytes were obtained from 198 ovarian pairs. The total mean numbers of oocytes and the mean numbers of oocytes with high quality (grade I) were significantly higher in ovarian pairs at the inactive stage (111.1 and 19.0 oocytes, respectively) than in ovarian pairs at the follicular stage (67.1 and 11.4 oocytes, respectively). A significant difference in the proportions of oocytes with grade I out of the total examined oocytes was observed between the follicular and luteal stages of ovaries (14.9% vs 20.2%, p < 0.05). The proportions of IVF embryos cleaved and developed to blastocysts significantly decreased with decreased quality of oocytes at recovery, irrespective of the reproductive status of ovaries. Moreover, there were no significant differences in the proportions of cleavage and development to the blastocyst stage of IVF and NT embryos among three oestrous stages of ovaries. These results indicate that the reproductive cycle stage of donor cat ovaries has no apparent effects on the in vitro development of oocytes after IVF and NT, but the quality of oocytes at recovery influences the development of IVF embryos.

126 EFFECTS OF THE REPRODUCTIVE STATUS ON DEVELOPMENTAL COMPETENCE OF RECIPIENT OOCYTES AFTER SOMATIC CELL NUCLEAR TRANSFER IN CAT

The reproductive status of donor cat has been suggested to influence developmental competence of the oocytes after IVM/IVF (Karja et al. 2002 Theriogenology 57, 2289–2298). This study was conducted to examine the effect of the reproductive cycle stage of cat ovaries supplying recipient oocytes for nuclear transfer (NT) on the developmental competence of the oocytes after somatic cell nuclear transfer. Cat ovaries were collected at local veterinary clinics and stored at 35°C for a short period (1–6 h). Based on the presence or absence of follicles and corpora lutea, the ovarian pairs collected were classified into the inactive, follicular or luteal stages. Cumulus-oocyte complexes (COCs) were obtained from ovaries at each stage of the reproductive cycle by mincing/dissection and matured in vitro for 24 h, as previously described (Karja et al. 2002 Theriogenology 57, 2289–2298). In vitro matured oocytes from ovaries at the inactive (n = 114), follicular (n = 124), and luteal (n = 126) stages were mechanically enucleated in PBS supplemented with 5 μL mL-1 of cytochalasin B and 3 mg mL-1 BSA, and reconstructed with fibroblast cells derived from uterus tissue. The couplets were fused in Zimmerman medium with a single DC pulse of 1.5 kV cm-1 for 50 μs. The successfully fused couplets were activated by a 5-min exposure to 10 μg mL-1 calcium ionophore A23187 in MK1 medium (Kanda et al. 1998 J. Vet. Med. Sci. 60, 423–431) followed by 5 h of incubation in MK1 medium supplemented with 10 μg mL-1 cycloheximide. The NT embryos were cultured in MK1 medium supplemented with 4 mg mL-1 BSA at 38.0°C in a humidified atmosphere of 5% CO2 in air. At 72 h of culture, all cleaved NT embryos were transferred to fresh MK1 medium supplemented with 5% fetal calf serum for an additional 4 days to evaluate their ability of development to the blastocyst stage. Data were analyzed by ANOVA. There were no significant differences (P > 0.05) among the fused oocytes derived from ovaries at the inactive, follicular, and luteal stages with respect to the percentages of cleavage (64.4%, 69.4%, and 74.5%, respectively) and blastocyst formation (17.4%, 21.0%, and 12.0%, respectively). These results indicate that the reproductive cycle stage of cat ovaries has no apparent effect on the development at competence of recipient oocytes after somatic cell nuclear transfer.

322 MEIOTIC COMPETENCE OF CANINE OOCYTES EMBEDDED IN COLLAGEN GELS

The low meiotic competence of canine oocytes cultured in vitro is a major obstacle to the in vitro production of canine embryos. The objectives of the present study were to examine meiotic competence of oocytes embedded in collagen gels and to investigate the effects of timed exposure of the oocytes embedded in collagen gels to hormone supplements on the nuclear maturation. Ovaries were collected from 17 bitches at various stages of the estrous cycles by ovariohysterectomy following anesthesia at local veterinary practices. Only non-degenerate COCs were collected and then suspended in TCM-199 supplemented with 5% fetal calf serum. Only oocytes with diameter >110 μm were selected and used for this study. In the first experiment, the effect of embedding in collagen gels of COCs on their meiotic competence was tested. Half of selected oocytes were embedded in 0.3 mL of collagen gels (3 to 4 COCs per gel) as described by Yamamoto et al. (Yamamoto K et al., 1999 Theriogenology 52, 81–89). The COCs with or without collagen gels were cultured in a dish containing 2.5 mL of TCM-199 supplemented with 0.1 IU mL-1 HMG and 10 IU mL-1 hCG (3 to 4 COCs per dish) for 72 h at 38.5°C in a humidified atmosphere of 5% CO2 in air. In the second experiment, the effect of removal of hormonal supplements from maturation medium on nuclear maturation in vitro was examined. At 24 and 48 h after the start of culture, the COCs embedded in collagen gels were cultured in TCM-199 without HMG and hCG for 48 and 24 h, respectively. As a control, the COCs embedded in collagen gels were cultured with hormone supplement for 72 h. After 72 of maturation culture, the oocytes were fixed, stained with Hoechst 33342 and examined for the meiotic stage of the oocytes using a fluorescence microscope. Data were analyzed by ANOVA. The proportion of oocytes that resumed meiosis was significantly higher (P < 0.05) in the COCs with collagen gels than in the control COCs without collagen gels (50.6 v. 26.5%). Significantly more oocytes reached metaphase I to metaphase II stage (MI/II) in the collagen gels culture than in the control culture (P < 0.05; 27.4 v. 8.3%). The proportion of collagen embedded-oocytes that resumed meiosis was significantly higher (P < 0.05) in COCs cultured with hormone supplements for 24 h than in COCs cultured for 48 h (59.1 v. 30.4%) but not different from COCs exposed for 72 h (41.9%). Moreover, there were no significant differences of MI/MII rates (22 to 24%) among the three treatment groups. These observations indicate that embedding of COCs in collagen gels enhances the meiotic competence of canine oocytes, but removal of hormone supplement from maturation medium does not improve the ability of the oocytes to reach MI/MII stage.