Qilin Wang

Fine Mapping of Wheat Stripe Rust Resistance Gene Yr26 Based on Collinearity of Wheat with Brachypodium distachyon and Rice

The Yr26 gene, conferring resistance to all currently important races of Puccinia striiformis f. sp. tritici (Pst) in China, was previously mapped to wheat chromosome deletion bin C-1BL-6-0.32 with low-density markers. In this study, collinearity of wheat to Brachypodium distachyon and rice was used to develop markers to saturate the chromosomal region containing the Yr26 locus, and a total of 2,341 F2 plants and 551 F2∶3 progenies derived from Avocet S×92R137 were used to develop a fine map of Yr26. Wheat expressed sequence tags (ESTs) located in deletion bin C-1BL-6-0.32 were used to develop sequence tagged site (STS) markers. The EST-STS markers flanking Yr26 were used to identify collinear regions of the rice and B. distachyon genomes. Wheat ESTs with significant similarities in the two collinear regions were selected to develop conserved markers for fine mapping of Yr26. Thirty-one markers were mapped to the Yr26 region, and six of them cosegregated with the resistance gene. Marker orders were highly conserved between rice and B. distachyon, but some rearrangements were observed between rice and wheat. Two flanking markers (CON-4 and CON-12) further narrowed the genomic region containing Yr26 to a 1.92 Mb region in B. distachyon chromosome 3 and a 1.17 Mb region in rice chromosome 10, and two putative resistance gene analogs were identified in the collinear region of B. distachyon. The markers developed in this study provide a potential target site for further map-based cloning of Yr26 and should be useful in marker assisted selection for pyramiding the gene with other resistance genes.

Emerging Yr26-Virulent Races of Puccinia striiformis f. tritici Are Threatening Wheat Production in the Sichuan Basin, China

Stripe rust, caused by Puccinia striiformis f. tritici, is one of the most destructive diseases of wheat in the world. The Sichuan Basin is one of the most important regions of wheat production and stripe rust epidemics in China. Stripe rust resistance gene Yr26 (the same gene as Yr24) has been widely used in wheat breeding programs and in many cultivars grown in this region since the gene was discovered in the early 1990s. Virulence to Yr26 has increased in frequency since its first detection in 2008. The objective of this study was to assess the vulnerability of the wheat cultivars and breeding lines in the Sichuan Basin to Yr26-virulent races. In total, 85 wheat accessions were tested with Yr26-avirulent races CYR32, CYR33, and Su11-4 and two Yr26-virulent races, V26/CM42 and V26/Gui22. DNA markers for Yr26 were used to determine the presence and absence of Yr26 in the wheat accessions. Of the 85 wheat accessions, only 5 were resistant and 19 susceptible to all races tested, and the remaining 61 were resistant to at least one or more races tested in seedling stage. In all, 65 (76.5%) accessions were susceptible to the emerging Yr26-virulent race V26/Gui22. In field tests, susceptible accessions increased from 31.8% in a nursery inoculated with predominant and Yr26-avirulent races to 61.2% in the nursery inoculated with the predominant races mixed with V26/Gui22. Based on the results of the molecular marker and race tests, 33 (38.8%) accessions were determined to have Yr26, showing that the Yr26 virulence is a major threat to wheat production in the Sichuan Basin and potentially in other regions of China.

First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum)

The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (Saccharum officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.

Stripe rust resistance in wheat breeding lines developed for central Shaanxi, an overwintering region for Puccinia striiformis f. sp. tritici in China

Abstract China is one of the largest stripe rust epidemic areas in the world. Central Shaanxi, an important overwintering region, serves as a ‘bridge’ between the western over-summering and eastern epidemic regions. Understanding of resistance levels and Yr-gene distribution in regional wheat breeding lines may provide valuable recommendations for releasing resistant cultivars for managing the disease. A total of 183 wheat breeding lines developed for central Shaanxi were tested for seedling resistance to nine Chinese races of Puccinia striiformis f. sp. tritici (Pst) in the greenhouse. In field tests, entries were evaluated for stripe rust resistance in Yangling, Shaanxi, an overwintering region for the pathogen and artificially inoculated with selected races. In Tianshui, Gansu Province, an over-summering region, entries were evaluated under natural infection of Pst. Molecular markers for Yr5, Yr9, Yr10, Yr15, Yr17, Yr18, Yr26 and Yr61 were used to determine the presence and absence of the genes. Among the 183 entries, 4 (2.2%) entries had effective all-stage resistance; 15 (8.2%) entries had adult-plant resistance; and 164 (89.6%) entries were susceptible to one or more races, especially to the potentially important races V26/CM42 and V26/Gui22. Over 95% of entries showed seedling stage susceptibility in Tianshui across years. Resistance genes Yr9, Yr17 and Yr24/Yr26 were postulated in some of the breeding lines based on the seedling responses and molecular markers. Yr5, Yr10, Yr15, Yr18 and Yr61 were not present in any of the breeding lines. These results suggest that, when multiple races of Pst disperse into Shaanxi from southern Gansu Province, over 90% of wheat breeding lines are susceptible. Based on the results, recommendations are made for releasing or not releasing the individual lines, and a strategy of combining genes for effective all-stage and adult-plant resistance is proposed for developing wheat cultivars with high-level durable resistance to stripe rust.

Combining Single Nucleotide Polymorphism Genotyping Array with Bulked Segregant Analysis to Map a Gene Controlling Adult Plant Resistance to Stripe Rust in Wheat Line 03031-1-5 H62

Stripe rust, caused by Puccinia striiformis f. sp. tritici, is one of the most devastating diseases of wheat worldwide. Growing resistant cultivars is considered the best approach to manage this disease. In order to identify the resistance gene(s) in wheat line 03031-1-5 H62, which displayed high resistance to stripe rust at adult plant stage, a cross was made between 03031-1-5 H62 and susceptible cultivar Avocet S. The mapping population was tested with Chinese P. striiformis f. sp. tritici race CYR32 through artificial inoculation in a field in Yangling, Shaanxi Province and under natural infection in Tianshui, Gansu Province. The segregation ratios indicated that the resistance was conferred by a single dominant gene, temporarily designated as YrH62. A combination of bulked segregant analysis (BSA) with wheat 90K single nucleotide polymorphism (SNP) array was used to identify molecular markers linked to YrH62. A total of 376 polymorphic SNP loci identified from the BSA analysis were located on chromosome 1B, from which 35 kompetitive allele-specific PCR (KASP) markers selected together with 84 simple sequence repeat (SSR) markers on 1B were used to screen polymorphism and a chromosome region associated with rust resistance was identified. To saturate the chromosomal region covering the YrH62 locus, a 660K SNP array was used to identify more SNP markers. To develop tightly linked markers for marker-assisted selection of YrH62 in wheat breeding, 18 SNPs were converted into KASP markers. A final linkage map consisting of 15 KASP and 3 SSR markers was constructed with KASP markers AX-109352427 and AX-109862469 flanking the YrH62 locus in a 1.0 cM interval. YrH62 explained 63.8 and 69.3% of the phenotypic variation for disease severity and infection type, respectively. YrH62 was located near the centromeric region of chromosome 1BS based on the positions of the SSR markers in 1B deletion bins. Based on the origin, responses to P. striiformis f. sp. tritici races, and marker distances, YrH62 is likely different from the other reported stripe rust resistance genes/quantitative trait loci on 1B. The gene and tightly linked KASP markers will be useful for breeding wheat cultivars with resistance to stripe rust.

Characterization and inheritance of resistance to stripe rust in the wheat line Guinong775: Characterization and inheritance of resistance to stripe rust in the wheat line Guinong775

Exploring different types of resistance genes and deploying diversity resistance genes among different wheat producing regions are important strategy to control stripe rust epidemic in large scale. The resistance spectra of the wheat line Guinong 775 at seedling stage was tested in greenhouse with ten isolates of Puccinia triticina West. f. sp. tritici; and the inheritance of resistance was investigate with F(2:3) and BC(1) populations derived from a cross between Guinong 775 and a susceptible cultivar Avocet (S), inoculated with isolates CYR32 and CH42, which poses a notable threat to current wheat varieties carrying Yr26 resistance gene. The results showed that Guinong 775 was immune or nearly immune to all the tested races; however, the resistant germplasm 92R137, Chuanmai 42, Guinong 22, and Yr24/6*Avocet (S) were susceptible to CH42. The resistance of Guinong 775 was conferred by a single dominant gene to CYR32 and another single dominant gene to CH42, and these genes proved to be different.

Saturation Mapping of a Major Effect QTL for Stripe Rust Resistance on Wheat Chromosome 2B in Cultivar Napo 63 Using SNP Genotyping Arrays

Stripe rust or yellow rust (YR), caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most important diseases of wheat (Triticum aestivum L.). Widespread deployment of resistant cultivars is the best means of achieving durable disease control. The red grain, spring wheat cultivar Napo 63 produced by CIMMYT in the 1960s shows a high level of adult-plant resistance to stripe rust in the field. To elucidate the genetic basis of resistance in this cultivar we evaluated 224 F2:3 lines and 175 F2:6 recombinant inbred lines (RILs) derived from a cross between Napo 63 and the Pst-susceptible line Avocet S. The maximum disease severity (MDS) data of F2:3 lines and the relative area under the disease progress curve (rAUDPC) data of RILs were collected during the 2014–2015 and 2015–2016 wheat growing seasons, respectively. Combined bulked segregant analysis and 90K single nucleotide polymorphism (SNP) arrays placed 275 of 511 polymorphic SNPs on chromosome 2B. Sixty four KASP markers selected from the 275 SNPs and 76 SSR markers on 2B were used to identify a chromosome region associated with rust response. A major effect QTL, named Qyrnap.nwafu-2BS, was identified by inclusive composite interval mapping and was preliminarily mapped to a 5.46 cM interval flanked by KASP markers 90K-AN34 and 90K-AN36 in chromosome 2BS. Fourteen KASP markers more closely linked to the locus were developed following a 660K SNP array analysis. The QTL region was finally narrowed to a 0.9 cM interval flanked by KASP markers 660K-AN21 and 660K-AN57 in bin region 2BS-1-0.53. The resistance of Napo 63 was stable across all environments, and as a QTL, explained an average 66.1% of the phenotypic variance in MDS of F2:3 lines and 55.7% of the phenotypic variance in rAUDPC of F5:6 RILs. The short genetic interval and flanking KASP markers developed in the study will facilitate marker-assisted selection, gene pyramiding, and eventual positional cloning of Qyrnap.nwafu-2BS.

Development and Validation of KASP-SNP Markers for QTL Underlying Resistance to Stripe Rust in Common Wheat Cultivar P10057

Stripe rust (Puccinia striiformis f. sp. tritici) is among the most important diseases of wheat (Triticum aestivum L.) globally. Utilization of adult plant resistance (APR) constitutes a key tool for maintaining protection against this disease. The CIMMYT wheat cultivar P10057 displayed a high level of APR to stripe rust in germplasm evaluation in field environments. To clarify the genetic basis and identify quantitative trait loci (QTLs) involved in stripe rust resistance in P10057, three wheat populations were used: 150 F5:6 recombinant inbred lines (RILs) derived from the cross Mingxian 169 × P10057, and 161 and 140 F2:3 lines from Avocet S × P10057 and Zhengmai 9023 × P10057, respectively. These three populations were evaluated for infection type (IT) and disease severity (DS) in Shaanxi, Gansu, and Sichuan during the 2014-15 and 2015-16 cropping seasons. Genotyping was performed with Kompetitive Allelic Specific PCR (KASP) and simple sequence repeat (SSR) markers linked to the resistance loci. Using QTL analysis, two genomic regions associated with resistance were found on chromosome arms 2BS and 3BS, respectively. These two stable QTLs, designated Qyrlov.nwafu-2BS and Qyrlov.nwafu-3BS, were detected across all environments and explained average 22.6 to 31.6% and 21.3 to 32.3% of stripe rust severity phenotypic variation, respectively. Qyrlov.nwafu-2BS may be the resistance allele derived from CIMMYT germplasm and Qyrlov.nwafu-3BS likely corresponds to the locus Sr2/Lr27/Yr30/Pbc. The KASP markers IWA5377, IWA2674, and IWA5830 linked to QYrlov.nwafu-2BS and IWB57990 and IWB6491 linked to Qyrlov.nwafu-3BS were reliable for marker-assisted selection (MAS) in the Zhengmai 9023 × P10057 population. These QTLs with KASP markers are expected to contribute in developing wheat cultivars with improved stripe rust resistance.

QTL mapping and validation of adult plant resistance to stripe rust in Chinese wheat landrace Humai 15

Stripe rust caused by Puccinia striiformis f. sp. tritici (Pst) is a devastating foliar disease that affects common wheat and barley throughout the world. The reasonable deployment of adult plant resistance (APR) wheat varieties is one of the best methods for controlling this disease. Wheat landraces are valuable resources for identifying the genes/QTLs responsible for disease resistance. Humai 15 is a Chinese spring wheat landrace and it has exhibited adequate levels of APR to the prevalent Pst races in field environments for many years. In this study, a population of 177 recombinant inbred lines (RILs) was derived from Humai 15 × Mingxian 169. After screening based on a 90K chip array using 45 RILs and Kompetitive Allelic Specific PCR marker genotyping for the population of RILs, a major effect QTL in Humai 15 was located on the centromere of chromosome 2B, where it accounted for up to 47.2% of the phenotypic variation. Two other minor QTL genes from Humai 15 were located on chromosome arms 3BS and 4BL. The Yr18 gene was identified on chromosome arm 7DS in Mingxian 169.