Rini Widayanti

Study of Genetic Marker of Cuscuses (Marsupialia: Phalangeridae) from Maluku and Papua Based on Cytochrome b Gene Sequences

Cuscuses is marsupials animal (Phalangeridae) which has limited spread in eastern Indonesia (Sulawesi, Maluku, Papua and Timor islands), Australia and Papua New Guinea. The ex-situ and in-situ conservation of cuscuses under captivating condition is an alternative solution to protect from extinction. This study aimed to determine nucleotide sequences and genetic marker on cyt b gene with sequencing method of each species on two provinces. Whole genome DNA was extracted from 22 samples of cuscuses obtained from different habitats, Maluku (13 individuals) and Papua (8 individuals) according to the protocol of Qiamp DNA Blood Mini Kit (Qiagen) and then it was used as template for amplification of cyt b gene by using PCR method. The PCR product were then purified using column chromatography and were used as template for sequencing reaction. Results sequencing of cyt b gene were analyzed using MEGA program versions 6.0. The PCR product gives results nucleotides of 982 bp according to database GeneBank and sequencing product gives results nucleotides of 771 bp. Nucleotides alignment of Phalanger members was found 24 nucleotides distinguishing and Spilocuscus members was found 11 nucleotides distinguishing, which can be used as genetic marker between Phalanger and Spilocuscus members from Papua and Maluku.

Molecular identification and genetic diversity of open reading frame 7 field isolated porcine reproductive and respiratory syndrome in North Sumatera, Indonesia, in the period of 2008-2014.

Aim: Molecular identification and genetic diversity of open reading frame 7 (ORF7) of field isolated porcine reproductive and respiratory syndrome virus (PRRSV) in North Sumatera, Indonesia, in the period of 2008-2014. Materials and Methods: A total of 47 PRRSV samples were collected from the death case of pigs. The samples were collected from different districts in the period of 2008-2014 from North Sumatera province. Two pairs of primer were designed to amplify ORF7 of Type 1 and 2 PRRSV based on the sequence of reference viruses VR2332 and Lelystad. Viral RNAs were extracted from samples using PureLink™ micro-to-Midi total RNA purification system (Invitrogen). To amplify the ORF7 of PRRSV, the synthesis cDNA and DNA amplification were performed by reverse transcription polymerase chain reaction (RT-PCR) and nested PCR method. Then the DNA sequencing of PCR products and phylogenetic analysis were accomplished by molecular evolutionary genetics analysis version 6.0 software program. Results: RT-: PCR and nested PCR used in this study had successfully detected of 18 samples positive PRRS virus with the amplification products at 703bp and 508bp, respectively. Sequencing of the ORF7 shows that 18 PRRS viruses isolated from North Sumatera belonged to North American (NA). JXA1 Like and classic NA type viruses. Several mutations were detected, particularly in the area of nuclear localization signal (NLS1) and in NLS2. In the local viruses, which were related closed to JXA1 virus; there are two differences in amino acids in position 12 and 43 of ORF7. Our tested viruses showed that the amino acid positions 12 and 43 are Asparagine and Arginine, while the reference virus (VR2332, Lelystad, and JXA1) occupied both by Lysine. Based on differences in two amino acids at position 12 and 43 showed that viruses from North Sumatera has its own uniqueness and related closed to highly pathogenic PRRS (HP-PRRS) virus (JXA1). Conclusion: The results demonstrated that North Sumatera type PRRS virus has caused PRRS outbreaks in pig in North Sumatera between 2008 and 2014. The JAX1 like viruses had unique amino acid residue in position 12 and 43 of asparagine and lysine, and these were genetic determinants of North Sumatera viruses compared to other PRRS viruses.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains. Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5’ GTGAGTGCAACCCCTTTAGGTTGT 3’ and reverse 3’ TAGACCCCAGTGATGCATGAGTTG 3’ with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program. Result: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%. Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

n-Propanol extract of boiled and fermented koro benguk (Mucuna pruriens seed) shows a neuroprotective effect in paraquat dichloride-induced Parkinson's disease rat model

Aim: n-Propanol extracts from fresh, boiled, and fermented seeds were studied to evaluate their neuroprotective effects in a Parkinson’s disease (PD) rat model, based on the total number of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc). Materials and Methods: Rats were induced with paraquat dichloride at a dosage of 7 mg/kg BW intraperitoneally twice a week and at the same time supplemented with extract at a dosage of 70 mg/kg BW orally every day for 3 weeks. On the 24th day, all rats were perfused and fixed with 4% paraformaldehyde. The left part of the SNpc was processed for immunohistochemical staining with tyrosine hydroxylase (TH)-antibody. The total number of DA neurons in SNpc was evaluated with a stereological method. Results: TH-immunoreactive cells found in the SNpc were identified as DA neurons. The average total number of DA neurons in the SNpc increased significantly in the PD rat model that was given an n-propanol extract of boiled and fermented seeds compared with a control PD rat model. Surprisingly, there was no significant difference in the average total number of DA neurons in SNpc between the PD rat model that was given n-propanol extract of fresh seeds and the control PD rat model. Conclusion: n-Propanol extract of boiled and fermented seeds could produce a higher neuroprotective effect against DA neuron than fresh seeds in a PD rat model.

KAJIAN DIVERSITI GENETIKA Tarsius sp. ASAL INDONESIA MENURUT URUTAN GEN NADH DEHIDROGENASE SUBUNIT 4 (ND4)

The aim of the study was to assess the genetic diversity ND4 coding genes in Tarsius bancanus, T. b. borneanus, T. dianae, and T. spectrum, and to reconfirm the taxonomy of Tarsius sp. Deoxyribonucleotides (DNA) specimens were isolated from tissue biopsy of each species of Tarsius using DNA extraction method then used for DNA template in the amplification process by means of polymerase chain reaction (PCR). Primers used in this study were designed specifically to amplify ND4 gene. The PCR result was then run for electrophoresis. PCR amplification results were then purified and used as template DNA for the reaction determination sequences of nucleotide. Sequences of ND4 nucleotide gene were blasted with other primates’ genes from Genbank using Clustal W. Furthermore, ND4 gene was analyzed based on amino acids sequence that were translated using Vertebrate mitochondrial translation code MEGA program software version 4.1 and phylogenetic tree were create using Neighbor Joining method. The results showed that 119 nucleotides sites out of 1378 were diverse. Genetic distance based on ND4 gene nucleotide that was calculated using Kimura two-parameter model shown the smallest value was 0.6%, while the largest value was 13%, and the average value is 6.1%. The phylogram based on the result of nucleotide sequence of ND4 genes using the Neighbor Joining method is useful for Tarsius sp. identification and distinguishing between species of Tarsius branch.