Rosanna Zobba

Equine and canine Anaplasma phagocytophilum strains isolated on the island of Sardinia (Italy) are phylogenetically related to pathogenic strains from the United States

ABSTRACT The presence of Anaplasma phagocytophilum, a tick-transmitted zoonotic pathogen, was investigated in Sardinia using a molecular approach. Phylogenetic analysis revealed that Sardinian strains are genetically distinct from the two lineages previously described in Europe and are closely related to strains isolated in different areas of the United States.

Molecular Investigation and Phylogeny of Anaplasma spp. in Mediterranean Ruminants Reveal the Presence of Neutrophil-Tropic Strains Closely Related to A. platys

ABSTRACT Few data are available on the prevalence and molecular typing of species belonging to the genus Anaplasma in Mediterranean ruminants. In this study, PCR analysis and sequencing of both 16S rRNA and groEL genes were combined to investigate the presence, prevalence, and molecular traits of Anaplasma spp. in ruminants sampled on the Island of Sardinia, chosen as a subtropical representative area. The results demonstrate a high prevalence of Anaplasma spp. in ruminants, with animals infected by at least four of six Anaplasma species (Anaplasma marginale, A. bovis, A. ovis, and A. phagocytophilum). Moreover, ruminants host a number of neutrophil-tropic strains genetically closely related to the canine pathogen A. platys. The high Anaplasma spp. prevalence and the identification of as-yet-unclassified neutrophil-tropic strains raise concerns about the specificity of serological tests routinely used in ruminants and provide additional background for reconstructing the evolutionary history of species genetically related to A. phagocytophilum.

Anaplasma phagocytophilum, Sardinia, Italy

To the Editor: Anaplasma phagocytophilum (formerly Ehrlichia phagocytophila), a tick-transmitted pathogen that infects several animal species, including humans (involved as accidental dead-end hosts), is the causative agent of human granulocytic anaplasmosis (HGA). It is a pathogen of veterinary importance responsible for tickborne fever of ruminants and for granulocytic anaplasmosis of horses and dogs (1,2). HGA was first described in the United States in 1994 (2) and is emerging in Europe (3). Although only 2 human cases have been reported in Italy (4), serologic and molecular findings have shown A. phagocytophilum infections in dogs and Ixodes ricinus ticks (5). Incidence, prevalence, and public impact of HGA and horse granulocytic anaplasmosis are, therefore, unknown for this geographic area. From 1992 to 1996, an average rate of 13.4 cases/year/100,000 inhabitants of tick bite–related fever of unknown etiology has been reported on the island of Sardinia, Italy, which is considerably higher than the corresponding national average value of 2.1 cases/year/100,000 inhabitants. Moreover, 117 cases of tick bite–related fever, whose etiology remains obscure, have been reported from 1995 to 2002 in the central west coast area of the island. Local newspapers occasionally report deaths as a result of tick bites, although no HGA-associated deaths have been documented in Europe. n nThis study investigated A. phagocytophilum in Sardinia. From 2002 to 2004, veterinarians based on the central west coast of the island were instructed to collect EDTA blood samples when a suspected case of tick bite–related fever was found at their clinics. A total of 70 blood samples were collected from 50 dogs and 20 horses that showed tick infestation and symptoms consistent with tickborne disease, such as fever, anorexia, jaundice (only in horses), anemia, myalgia, and reluctance to move. Genomic DNA was extracted from the buffy coat obtained by centrifugation of 2 to 4 mL of blood, as previously described (6). Furthermore, DNA was extracted from 50 Rhipicephalus sanguineus ticks removed from 30 dogs. Primers EphplgroEL(569)F (ATGGTATGCAGTTTGATCGC), EphplgroEL(1193)R (TCTACTCTGTCTTTGCGTTC), and EphgroEL(1142)R (TTGAGTACAGCAACACCACCGGAA) were designed and used in combination to generate a heminested polymerase chain reaction (PCR) for the selective amplification of 573 bp of the groEL gene of A. phagocytophilum. The final 50 μL PCR volume of the first PCR round contained 5 μL of the DNA extraction, primers EphplgroEL(569)F and EphplgroEL(1193)R, and HotMaster Taq DNA polymerase (5u/μL, Eppendorf) according to the manufacturers basic protocol (Eppendorf AG, Hamburg, Germany). Heminested PCR was performed by using 5 μL of each of the first PCR products and primer EphgroEL(1142)R. To confirm the PCR diagnosis, amplicons were digested with the HindIII restriction endonuclease (predicted digestion pattern: 3 fragments of 525 bp, 21 bp, and 27 bp). Anaplasma phagocytophilum DNA was obtained from strain NCH-1 and used as positive control in PCR reactions. Sequences were obtained by cloning the PCR products into the pCR2.1-TOPO vector (Invitrogen S.R.L., Milan, Italy) and using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA, USA), according to the protocols supplied by the manufacturers. Sequences ({type:entrez-nucleotide,attrs:{text:AY848751,term_id:56463268,term_text:AY848751}}AY848751, {type:entrez-nucleotide,attrs:{text:AY848747,term_id:56463260,term_text:AY848747}}AY848747) were aligned to the corresponding region of other species belonging to Rickettsiales by using ClustalX (7). Genetic distances among species were computed by the Kimura 2-parameters method by using MEGA, and were used to construct bootstrapped neighbor-joining trees (8). n nOf 120 DNA samples, 1 tick, 3 dog, and 3 horse samples generated the predicted band of 573 bp representative of the groEL gene of A. phagocytophilum. HindIII digestions confirmed PCR diagnosis (Figure A1). Two different groEL sequence types were obtained from 1 dog and 1 horse and confirmed by BLAST (http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/information3.html) queries as A. phagocytophilum groEL sequences (average identity 99%; average E value = 0), indicating that sequences did not reflect contamination. Bootstrapped neighbor-joining trees confirmed the identity of the new sequences obtained, which are closely related to HGA strains isolated in Europe and the United States (Figure). n nThe molecular approach applied in this study established A. phagocytophilum in an area of Sardinia characterized by a high prevalence of tick bite–related fever in humans and animal species. To our knowledge, this is the first evidence of A. phagocytophilum in Sardinian dogs and horses and the first documentation of infection in Italian horses caused by pathogenic strains. Therefore, these findings suggest the emergence of Anaplasma phagocytophilum in Italy. Ixodes ricinus ticks are indicated as vectors transmitting A. phagocytophilum in Europe. Although only 0.3% of 4,086 ticks collected in 72 sites of Sardinia (9) have been identified as Ixodes, other tick species are better represented on the island (Rhipicephalus, 67.2%; Haemaphysalis, 24.1%; Dermacentor, 4.9%). A. phagocytophilum in 1 Rhipicephalus sanguineus could indicate a role of this tick in the epidemiology of HGA. Finally, these data indicate the presence of a potential threat to human and animal health and suggest activation of further epidemiologic surveillance and controls. n n n nFigure n nBootstrapped neighbor-joining tree of several species belonging to Rickettsiales and identification of the strains isolated during the study as Anaplasma phagocytophilum. Strains associated to Sardinian groEL variants are closely related to European and ...

Cell tropism and molecular epidemiology of Anaplasma platys-like strains in cats.

Bacterial species of the genus Anaplasma are tick transmitted pathogens that negatively impact on animal productions and generate veterinary and public health concerns. This paper reports the identification, molecular characterization and phylogeny of novel unclassified A. platys-like strains in cats. Interestingly, these novel strains are closely related to conspecific strains recently identified in ruminants, and significantly differ from A. platys. A. platys-like strains in cats, unlike ruminants strains, show tropism for platelets. Results have implications in the diagnostic scenario of animal anaplasmosis and provide background for reconstructing the evolutionary history of species genetically related to A. platys.

Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica

Although vector-borne diseases are globally widespread with considerable impact on animal production and on public health, few reports document their presence in Central America. This study focuses on the detection and molecular identification of species belonging to selected bacterial genera (Ehrlichia, Anaplasma and Rickettsia) in ticks sampled from dogs in Costa Rica by targeting several genes: 16S rRNA/dsb genes for Ehrlichia; 16S rRNA/groEL genes for Anaplasma, and ompA/gltA/groEL genes for Rickettsia. PCR and sequence analyses provides evidences of Ehrlichia canis, Anaplasma platys, and Anaplasma phagocytophilum infection in Rhipicephalus sanguineus s.l ticks, and allow establishing the presence of Rickettsia monacensis in Ixodes boliviensis. Furthermore, the presence of recently discovered Mediterranean A. platys-like strains is reported for the first time in Central America. Results provide new background on geographical distribution of selected tick-transmitted bacterial pathogens in Costa Rica and on their molecular epidemiology, and are pivotal to the development of effective and reliable diagnostic tools in Central America.

First Molecular Identification and Phylogeny of a Babesia sp. from a Symptomatic Sow (Sus scrofa Linnaeus 1758)

ABSTRACT Porcine babesiosis is a widespread yet overlooked disease causing economic losses in many regions of the world. To date, the etiological agent of porcine babesiosis has not been molecularly characterized. Here, we provide the first molecular characterization of a piroplasm detected in a symptomatic sow, phylogenetically closely related to the Ungulibabesids. Results pave the way for future molecular epidemiology studies.

Seroprevalence of Bartonella henselae in Dogs and Cats in Sassari

Pinna Parpaglia, M.L., Masu, G., Masala, G., Porcu, R., Zobba, R., Pintori, G. and Cocco, R., 2007. Veterinary Research Communications, 31(Suppl. 1), 317–320

Molecular typing and diagnosis of Anaplasma spp. closely related to Anaplasma phagocytophilum in ruminants from Tunisia

Accurate diagnosis of animal and zoonotic diseases, such as granulocytic anaplasmosis, is crucial to estimate risk during control programs. In this study, 16S rRNA nested PCR and RFLP assay were combined to investigate the presence of Anaplasma phagocytophilum and genetically related strains (namely A. phagocytophilum-like 1 and 2) in 936 Tunisian ruminants. By using this method, A. phagocytophilum was not detected in any of the tested animals, while A. phagocytophilum-like 1 and A. phagocytophilum-like 2 were detected at variable prevalence rates in sheep, goats and cattle at coinfection rates respectively of 3.9, 2.5 and 0.5%. Sequence analysis validated RFLP data, and confirmed the co-occurrence of two potentially novel species closely related to A. phagocytophilum in Tunisian ruminants. Phylogeny indicated the presence of genetic variants shared by different ruminant species for each type of A. phagocytophilum-like strains. Results raise concern on the use and interpretation of indirect and direct tests traditionally employed for detecting pathogenic A. phagocytophilum strains in ruminants and in other vertebrates species, and provide additional background to improve classification of bacterial species closely related to A. phagocytophilum, and to reconstruct their evolutionary history.

Genetic immunization with the immunodominant antigen P48 of Mycoplasma agalactiae stimulates a mixed adaptive immune response in BALBc mice

A DNA vaccine against contagious agalactia was developed for the first time, encoding the P48 of Mycoplasma agalactiae. Specific immune responses elicited in BALB/c mice were evaluated. Both total IgG and IgG1 were detected in mice vaccinated with pVAX1/P48. Proliferation of mononuclear cells of the spleen, levels of gamma interferon, interleukin-12, and interleukin-2 mRNAs were enhanced in immunized animals. Results indicate that pVAX1/P48 vaccination induced both T(h)1 and T(h)2 immune responses. Nucleic acid immunization could be a new strategy against M. agalactiae infections and may be potentially used to develop vaccines for other Mycoplasma diseases.

Anaplasma platys-like strains in ruminants from Tunisia

Molecular diagnosis of Anaplasma platys and related strains (A. platys-like) in carnivores and ruminants is challenging due to co-infections with cross-reacting strains, and require post-amplification sequencing of the hemi-nested PCR products traditionally generated by targeting the groEL gene. In this study, a Restriction Enzyme Fragment Length Polymorphism (RFLP) assay coupled to hemi-nested groEL PCR was developed to discriminate among A. platys and genetically related strains. This novel approach was used for investigating A. platys-like infection in 963 domesticated ruminants (241 goats, 355 sheep, and 367 cattle) from 22 delegations located in North Tunisia. Overall prevalence rates of A. platys-like were 22.8, 11, and 3.5% in goats, sheep, and cattle, respectively. Alignment, identity comparison, and phylogenetic analysis of the groEL sequence variants obtained in this study confirmed RFLP data suggesting that Tunisian ruminants are infected by novel unclassified Anaplasma strains genetically related to A. platys. Compared to sequencing, RFLP assay allows fast detection of A. platys and A. platys-like pathogens in the same sample and has a potential value especially when screening ticks, cats and ruminants, which can be a common host for these two bacteria. This newly developed molecular technique would provide valuable molecular tool for epidemiological studies related to A. platys as well as remove concern over specificity of serological and molecular methods routinely used to identify diverse Anaplasma strains and species in wild and domestic ruminants.