S. W. Scott

Nucleotide sequences of segments 1, 3 and 4 of the genome of Bombyx mori cypovirus 1 encoding putative capsid proteins VP1, VP3 and VP4, respectively

The complete nucleotide sequences of genomic segments S1, S3 and S4 from Bombyx mori cypovirus 1 (BmCPV-1) have been determined. The segments consisted of 4190, 3846 and 3262 nucleotides encoding putative proteins of 1333, 1239 and 1058 amino acids with molecular masses of approximately 148, 140 and 120 kDa (p148, p140 and p120, respectively). All segments possess a single open reading frame. Homology searches showed that all three proteins have homologies to proteins of Rice ragged stunt virus, a member of the genus Oryzavirus within the family REOVIRIDAE: Partial homologies of p140 to structural proteins in other viruses were also found. The predicted molecular masses and the homologies with structural proteins in other viruses lead us to suggest that S1, S3 and S4 encode the capsid proteins VP1, VP3, and VP4, respectively, of BmCPV-1.

Comparison of the amino acid sequences of RNA-dependent RNA polymerases of cypoviruses in the family Reoviridae

Summary. The nucleotide sequences of the genome segment S2 of Bombyx mori cypovirus 1, S2 of Lymantria dispar cypovirus 1, S1 of Lymantria dispar cypovirus 14 and S1 of a proposed new electropherotype of Trichoplusia ni cypovirus 15 were determined. These segments encoded putative RNA-dependent RNA polymerases (RDRPs). The deduced amino acid sequences of RDRPs within the genus Cypovirus showed 32% to 94% identities, while extent of homology between RDRPs in the genera Cypovirus and Oryzavirus, a genus most closely related, was approximately 26% identity. Both the genera Cypovirus and Oryzavirus might have originated from a common insect virus ancestor.

Viruses in subgroup 2 of the genus Ilarvirus share both serological relationships and characteristics at the molecular level

Summary. Sequence data have been determined for 5 members of subgroup 2 of the genus Ilarvirus. These data support the known serological relationships among accepted members of this group and indicate that the ilarvirus Hydrangea mosaic virus (HdMV) is an isolate of Elm mottle virus (EMoV). The close relationships between members of this subgroup, exhibited through the coat proteins coded on RNA 3, extend to the other genomic molecules. Primers designed from the sequences of RNA 1 and RNA 2 of EMoV amplified fragments from all other subgroup 2 viruses but not from other ilarviruses. Although closely related, members of this subgroup occur naturally in distinctly different host species. The possible origins of the viruses are discussed in relation to similarities among the genomic molecules, in particular RNA 3.

The sequence of RNA 1 and RNA 2 of tobacco streak virus: additional evidence for the inclusion of alfalfa mosaic virus in the genus Ilarvirus.

SummaryHere we describe the complete sequence of RNA 1 and 2 of the WC isolate of tobacco streak virus (TSV). These two sequences complete the information on the genome of TSV, the type member of the genus Ilarvirus, and are the first sequences described for the RNA 1 and RNA 2 of a member of subgroup 1 of this genus. The sequences have a similar organization to those reported for the corresponding RNAs of other ilarviruses. However, the putative translation products of these two molecules differ sufficiently from previously sequenced ilarviruses so that TSV should remain in a subgroup on its own. Phylogenetic comparison of sequence data for RNA 1 with that of other ilarviruses and alfalfa mosaic virus (AMV) reveals two distinct clusters (TSV, CiLRV, and SpLV) and (AMV, PDV, and ApMV). These data support the suggestion [16] based on data for RNA 3 of ilarviruses that AMV should be included as a true ilarvirus.

The Molecular Biology of Ilarviruses

Ilarviruses were among the first 16 groups of plant viruses approved by ICTV. Like Alfalfa mosaic virus (AMV), bromoviruses, and cucumoviruses they are isometric viruses and possess a single-stranded, tripartite RNA genome. However, unlike these other three groups, ilarviruses were recognized as being recalcitrant subjects for research (their ready lability is reflected in the sigla used to create the group name) and were renowned as unpromising subjects for the production of antisera. However, it was recognized that they shared properties with AMV when the phenomenon of genome activation, in which the coat protein (CP) of the virus is required to be present to initiate infection, was demonstrated to cross group boundaries. The CP of AMV could activate the genome of an ilarvirus and vice versa. Development of the molecular information for ilarviruses lagged behind the knowledge available for the more extensively studied AMV, bromoviruses, and cucumoviruses. In the past 20 years, genomic data for most known ilarviruses have been developed facilitating their detection and allowing the factors involved in the molecular biology of the genus to be investigated. Much information has been obtained using Prunus necrotic ringspot virus and the more extensively studied AMV. A relationship between some ilarviruses and the cucumoviruses has been defined with the recognition that members of both genera encode a 2b protein involved in RNA silencing and long distance viral movement. Here, we present a review of the current knowledge of both the taxonomy and the molecular biology of this genus of agronomically and horticulturally important viruses.

Common Multiple dsRNAs Are Present in Populations of the Fungus Discula destructiva Originating from Widely Separated Geographic Locations

DsRNAs were detected in 85/108 isolates of Discula destructiva, the cause of dogwood anthracnose, collected in South Carolina, Idaho, and Alabama. The eastern isolates contained a greater diversity of dsRNA than did Idaho isolates, but most isolates, irrespective of state of origin, contained two small bands (ca. 1.5–2.5 kb) with sequence homology indicated by Northern hybridization. Differences in the banding patterns suggest that genetic diversity of dsRNA in D. destructiva is generated rapidly and that D. destructiva can be simultaneously infected by multiple dsRNA viruses.

The complete sequence of the genomic RNAs of spinach latent virus

SummaryWe describe the sequence for the complete genome of spinach latent virus (SpLV). Comparisons of this genome with that of the only other complete genome described for a species within the genus Ilarvirus (citrus leaf rugose virus – CiLRV) indicate that while there are marked differences between the RNA 3 of the two viruses, their respective RNAs 1 and 2 share many similarities. However, the putative 2a protein of SpLV contains a C2H2 type “zinc finger”-like motif located towards the carboxy terminal of the protein which is absent in CiLRV and has not been reported for other members of the family Bromoviridae. A second open reading frame (2b), located at a similar position to that described for the cucumoviruses, occurs in the RNA 2 of both SpLV and CiLRV. The putative coat protein of SpLV is similar to that of citrus variegation virus (CVV) and asparagus virus 2 (AV-2), both members of subgroup 2 of the ilarviruses. We have subsequently demonstrated a serological relationship between SpLV and other viruses in subgroup 2 and suggest that SpLV should be included in this subgroup rather than remain in a separate group (subgroup 6). However, while the putative movement protein of SpLV is remarkably similar to that of AV-2, it shows little relationship with the corresponding protein of CVV and the lack of similarity suggests that a recombination event may have occurred in the past. The relationship between the genera Alfamovirus and Ilarvirus is discussed in the light of the data for the genome of SpLV and recently published information for other members of the genus Ilarvirus.

The complete nucleotide sequence of an isolate of apple chlorotic leaf spot virus from peach (Prunus persica (L.) Batch)

Apple chlorotic leaf spot virus (ACLSV) is the type member of the genus Trichovirus [3] and infects members of the family Rosaceae. It is frequently referred to as ‘‘one of the apple latent viruses’’ and has been moved around the world in apple germplasm. In pome and stone fruits the virus causes a number of economically important conditions [10, 11]. Although the virus is commonly found in apple germplasm in the USA, the distinct diseases of apricot and peach caused by ACLSV reported in Europe [12] have not been observed. The prunus germplasm ‘Ta Tao 5’ (PI101667), imported into the USA from China in 1933 [1] has, in the past decade, been used in the southeastern USA as an interstem to delay bloom and moderate the effects of late spring freezes on the peach crop [13]. Shortly after this work was initiated, it became clear that the effects of the interstem were neither genetic nor physiological but associated with graft-transmissible agents [4]. Plants of Nicotiana occidentalis 37B mechanically inoculated with sap from leaves of ‘Ta Tao 5’ produced a systemic mottle. Attempts at purifying the agent in N. occidentalis [6] yielded a partially purified preparation of a filamentous virus. cDNA synthesized using RNA extracted from this preparation and an oligo-dt primer was cloned. Several clones of approximately 600 nucleotides (nt) in length were obtained and sequenced. These sequences shared greater than 85% similarity with the corresponding region of the genome of ACLSV (GenBank accession M58152) and represented the carboxy terminal portion of the coat protein (CP) and the 30 non-coding region (NCR) of the virus [4]. Here, we describe the full-length sequence for the isolate of ACLSV detected in ‘Ta Tao 5.’ This sequence is the first published sequence for the complete genome of an isolate of ACLSV infecting peach and, because of its history and the mode of transmission of ACLSV, is possibly the first complete genomic sequence for an isolate of the virus from China. Three trees propagated from a single source of ‘Ta Tao 5’ and maintained at the Musser Farm Research Center, Clemson University, were used as sources of material for extraction of total RNA and for sap inoculation to N. occidentalis. The 30 terminal region of the genome (671 nt long) was as described previously [4]. The remainder of the sequence was determined by cloning a series of fragments amplified using PCR into the vector pGEM -T Easy (Promega, Madison, WI), sequencing these fragments, and assembling the contiguous sequence as described previously [15]. A 390-nt fragment from the polymerase coding region of ACLSV was amplified by One-Step PCR (QIAGEN, Valencia, CA), using Kummert’s primers [7]. To fill the gap between this sequence and the 30 terminal region of the genome, specific primers (50 GATGTTCCTTGAAC CGCGATGTTTGCGAAGATGG 30—downstream) and (50 GTGCGCTCTGAGGAACCTAAAAGAGACTGAGG 30—upstream) were designed from the sequence information of the 671-nt and 390-nt clones, respectively. A 1.5 kb product was amplified using the Advantage 2 PCR System The sequence described in this manuscript has been deposited with GenBank as accession number EU223295.

The nucleotide sequence of hydrangea mosaic virus RNA 3 exhibits similarity with the RNA 3 of tobacco streak virus

The complete nucleotide sequence of the RNA 3 of hydrangea mosaic virus (HdMV) was determined. It consists of 2268 nucleotides and contains two open reading frames (ORF). ORF 1 encodes for a putative translation product of 293 amino acids which shared 64.9% identity with the 3a protein of tobacco streak virus (TSV). ORF 2 encodes for a putative translation product of 220 amino acids which shared 54.2% identity with the coat protein of TSV. The relationship between the proteins of HdMV and the corresponding proteins of ilarviruses other than TSV was more distant. No zinc-finger-like motif was found in the coat protein of HdMV but the N-terminus of the protein was rich in basic amino acids. Both terminal, non-coding regions of HdMV RNA 3 contained repeated sequences with corresponding homologous fragments in the RNA 3 of TSV. On the basis of the similarities between HdMV and TSV that we detected, we propose that HdMV be included in subgroup 1 of the genus Ilarvirus together with TSV.

Differences between the coat protein amino acid sequences of English and Scottish serotypes of Raspberry ringspot virus exposed on the surface of virus particles

The region of the RNA 2 coding for the putative helper/movement protein and the coat protein (CP) of each of six isolates of Raspberry ringspot virus was sequenced and these sequences were compared with the published sequence of the Scottish type isolate. Minimal differences were detected among the putative translations of the helper/movement proteins, however, multiple alignment and phylogenetic analysis of the putative CPs separated the English and Scottish serotypes into two distinct clades. Superimposing the amino acid sequences of the CPs of these two serotypes on the 3D model for the CP of a comovirus/nepovirus, showed that eight of the differences identified between the two serotypes occurred on the surface of the protein. Inspection of the recently reported structure of the capsid protein of Tobacco ringspot virus, the type member of the genus Nepovirus, indicated identical locations for these differences. The change of H (Scottish isolates) to R (English isolates) at position 219 in the amino acid sequences of the viruses occurred on an exposed, erect surface loop. The potential role of this change, and other unique differences between the amino acid sequences of the two serotypes, in the specificity of nematode transmission of the virus is discussed.