Sandrine Boutboul

Predicted Long-term Outcome of Corneal Transplantation

OBJECTIVE To analyze graft survival and the outcome of the corneal endothelium after corneal transplantation in a single model to predict the long-term prognosis of these grafts. DESIGN Cohort study. Data were recorded prospectively and then analyzed retrospectively. PARTICIPANTS One thousand one hundred forty-four consecutive eyes of 1144 patients who underwent corneal transplantation between 1992 and 2006. INTERVENTIONS Penetrating keratoplasty and deep anterior lamellar keratoplasty. MAIN OUTCOME MEASURES Slit-lamp examination and wide-field specular microscopy results. A joint analysis of endothelial cell loss and time to graft failure was undertaken. From midterm simultaneous analysis of graft survival and endothelial cell loss, long-term graft survival was predicted. RESULTS The observed 5- and 10-year graft survival estimates were, respectively, 74% and 64%. The average endothelial cell density (cell loss) was 2270 cells/mm(2) before surgery, 1058 cells/mm(2) (-53%) during the sixth postoperative year, and 865 cells/mm(2) (-61%) during the 10th postoperative year. Overall, the predicted graft survival estimate was 27% at 20 years and 2% at 30 years. Both observed and predicted graft survival were higher in patients who had undergone lamellar keratoplasty than in patients who had undergone penetrating keratoplasty and had normal recipient endothelium and higher in patients who had undergone penetrating keratoplasty and had normal recipient endothelium than in patients who had undergone penetrating keratoplasty and had impaired recipient endothelium. CONCLUSIONS For corneal diseases involving the endothelium, penetrating keratoplasty seems to be a good therapeutic approach in elderly patients because the graft life-span may be similar to the patient life expectancy. Conversely, for younger patients, penetrating keratoplasty is only a midterm therapeutic approach. For corneal diseases not involving the endothelium, deep anterior lamellar keratoplasty seems to be a promising therapeutic approach with higher long-term expected survival.

New test for the diagnosis of bacterial endophthalmitis

Background: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. Methods: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure®) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. Results: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/μl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. Conclusion: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Rapid detection and quantification of Propionibacteriaceae

Background: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). Material and methods: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5′ATACGTAGGGTGCGAGCGTTGTCC; 5′TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95°C, 20 s and 45 cycles at 95°C, 3 s and 30 s at 60°C. DNA extraction yields were assessed in the same tube. Results: This test detects as few as 0.01 Equivalent PFU/μl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. Conclusion: The new real-time PCR is able to detect 0.01 Eq/CFU μl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Pigmentary glaucoma secondary to in-the-bag intraocular lens implantation

After uneventful phacoemulsification and in-the-bag implantation of an AcrySof SA60AT (Alcon) intraocular lens (IOL), a 52-year-old black man developed pigmentary glaucoma. Slitlamp examination, anterior segment optical coherence tomography, and ultrasound biomicroscopy showed that the posterior surface of the iris was being rubbed by the inferior haptic of the IOL, which was in the bag but deformed. Filtering surgery was needed to control the intraocular pressure. This type of IOL can cause IOL-induced pigmentary glaucoma.

425 Décollement de rétine sur œil greffé de la cornée

Introduction La frequence des decollements de retine chez les patients greffes est de l’ordre de 2 a 5,4 % selon la litterature. Il s’agit d’une complication grave dont le pronostic visuel est mauvais dans la plupart des etudes. Ces mauvais resultats sont imputes a la possibilite de retard diagnostique et a la difficulte de visualisation du fond d’œil. Materiels et Methodes L’etude retrospective a porte sur sept patients (huit yeux) greffes qui ont presente un decollement de retine opere dans le service entre 2003 et 2008. Dans la plupart des cas, le decollement de retine est survenu apres un traumatisme avec lâchage de suture chez des patients jeunes greffes pour keratocone (3 cas) ou pour glaucome congenital (1 cas). Les autres cas de decollement de retine sont survenus chez des patients greffes pour decompensation endotheliale sur chirurgie de la cataracte avec issue de vitre (4 cas). La geste chirurgical realise a ete une vitrectomie avec tamponnement interne dans sept cas, et cryo-indentation seule dans un cas. La vitrectomie a ete possible, meme lors de mauvaise transparence du greffon, grâce a l’utilisation d’un mini quad avec inverseur dans tous les cas. Resultats Le succes anatomique a ete de 100 % apres une seule chirurgie dans 6 cas (75 %) et deux chirurgies (recidive par PVR) dans deux cas. Les patients ont recupere une acuite visuelle superieure a 2/10 dans 2 cas (25 %), superieure ou egale a 1/20 dans 3 cas (37,5 %) et limitee a VLMB dans les autres cas (37.5 %). Les principaux facteurs de mauvais pronostic sont : l’existence d’une atteinte maculaire (macula soulevee, OMC ou trou maculaire associe au DR) et le retard diagnostic. Discussion Les traumatismes oculaires et les ruptures capsulaires avec issue de vitre sont responsables de la majorite des cas de decollement de retine dans cette serie de patients greffes. Conclusion Il est essentiel de sensibiliser les jeunes patients greffes a la necessite de se proteger les yeux. Le pronostic visuel dans ce type de chirurgie est d’autant meilleur que le diagnostic et la prise en charge sont rapides.

323 Évolution de la densité cellulaire endothéliale après kératoplastie

Objectif Analyser l’evolution de la population cellulaire endotheliale apres keratoplastie. Materiels et Methodes Etude de cohorte observationnelle retrospective incluant 1 144 keratoplasties transfixiantes et keratoplasties lamellaires anterieures centrales consecutives realisees entre 1992 et 2006. Une microscopie speculaire grand champ a ete realisee pendant la 2° (A2), la 4° (A4), la 6° (A6) et la 10° (A10) annee post-operatoire. Resultats Le suivi moyen des patients est de 60 mois. Dans le groupe des keratoplasties lamellaires anterieures centrales, la densite endotheliale moyenne (cellules/mm 2 ) et la perte cellulaire correspondante sont de 2093 (−11 %) a A2 et 2037 (−14 %) a A4. Dans le groupe des keratoplasties transfixiantes faites chez des patients ayant un endothelium normal en pre-operatoire, la densite endotheliale moyenne est de 1 767 (−24 %) a A2, 1 398 (−40 %) a A4, 1 096 (−51 %) a A6, et 853 (−61 %) a A10. Dans le groupe des keratoplasties transfixiantes faites pour une pathologie endotheliale, la densite endotheliale moyenne est de 1 414 (−36 %) a A2, 1 142 (−49 %) a A4, 981 (−56 %) a A6, et 920 (−58 %) a A10. Parmi les patients operes de keratoplasties transfixiantes, la survie du greffon est d’autant plus importante que la densite cellulaire endotheliale a 1 an est elevee. Elle n’est par contre pas influencee par la densite endotheliale pre-operatoire du greffon. Discussion Apres keratoplastie transfixiante, la perte cellulaire endotheliale constitue le facteur limitant de la survie du greffon a long terme. Si les densites sont plus elevees a court terme chez les patients ayant un endothelium normal avant keratoplastie transfixiante, a moyen et long terme ce facteur n’influence plus l’evolution de la population cellulaire endotheliale qui se rarefie inexorablement. Conclusion La perte cellulaire endotheliale post-operatoire apres keratoplastie lamellaire anterieure est tres faible et devrait permettre une survie du greffon a tres long terme.