Seong K. Kim

Characterization of the trans-Activation Properties of Equine Herpesvirus 1 EICP0 Protein

ABSTRACT The EICP0 protein of equine herpesvirus 1 (EHV-1) is an early, viral regulatory protein that independently trans-activates EHV-1 immediate-early (IE), early, γ1 late, and γ2 late promoters. To assess whether this powerful trans-activator functions in conjunction with three other EHV-1 regulatory proteins to activate expression of the various classes of viral promoters, transient cotransfection assays were performed in which effector plasmids expressing the EICP22, EICP27, and IE proteins were used either singly or in combination with an EICP0 effector construct. These analyses revealed that (i) independently, the EICP0 and IE proteins are powerfultrans-activators but do not function synergistically, (ii) the IE protein inhibits the ability of the EICP0 protein totrans-activate the IE, γ1 late, and γ2 late promoters, (iii) the EICP22 and EICP0 proteins do not function together to significantly trans-activate any EHV-1 promoter, and (iv) the EICP27 and EICP0 proteins function synergistically totrans-activate the early and γ1 late promoters. A panel of EICP0 truncation and deletion mutant plasmids was generated and used in experiments to define the domains of the 419-amino-acid (aa) EICP0 protein that are important for the trans-activation of each class of EHV-1 promoters. These studies revealed that (i) carboxy-terminal truncation mutants of the EICP0 protein exhibited a progressive loss of trans-activating ability as increasing portions of the carboxy terminus were removed, (ii) the amino terminus of the EICP0 protein containing the RING finger (aa 8 to 46) and the acidic region (aa 71 to 84) was necessary but not sufficient for activation of all classes of EHV-1 promoters, (iii) the RING finger was absolutely essential for activation of EHV-1 promoters, since deletion of the entire RING finger motif (aa 8 to 46) or a portion of it (aa 19 to 30) completely abrogated the ability of these mutants to activate any promoter tested, (iv) the acidic region contributed to the ability of the EICP0 protein to activate the early and γ1 late promoters, and deletion of the acidic region enhanced the ability of this mutant to activate the IE promoter, (v) the carboxy terminus (aa 325 to 419), which is rich in glutamine residues, was dispensable for the EICP0trans-activation function, (vi) a motif resembling a nuclear localization signal (aa 289 to 293) was unnecessary for the EICP0 protein to trans-activate promoters of any temporal class, and (vii) the EICP0 protein was phosphorylated during infection, and deletion of the serine-rich region (aa 210 to 217), a potential site for phosphorylation, reduced by more than 70% the ability of the EICP0 protein to activate the γ2 late class of promoters.

Characterization of the transactivation domain of the equine herpesvirus type 1 immediate-early protein.

Equine herpesvirus type 1 (EHV-1) possesses a sole diploid immediate early gene (IE) that encodes a major regulatory protein of 1487 amino acids capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a series of GAL-4-IE fusion constructs, we previously demonstrated that the minimal transactivation domain (TAD) of the IE protein maps within amino acids 3-89. Additional studies revealed that that the carboxyl terminus of the IE protein may be required for full transactivation activity in vitro. Analyses of the minimal TAD revealed the presence of 13 acidic amino acids and six basic residues giving the TAD region a net negative charge of -7. In addition, there are conserved hydrophobic residues (Leu(12) and Phe(15)) that may be critical for transactivation function. To identify residues essential for IE transactivation and to ascertain if the overall net negative charge of the TAD or the position of specific hydrophobic residues within the IE TAD are critical for the transactivation function, plasmids expressing mutant forms of the TAD were generated using specifically designed mutagenic oligonucleotides and PCR mutagenesis. Mutagenized TADs in which the acidic and hydrophobic amino acid residues were replaced, singly and in combination, with polar, uncharged amino acids were cloned into a GAL-4/CAT reporter expression system and assayed in transient transfection assays. To determine if the carboxyl terminus is necessary for full transactivation activity, a series of constructs that express forms of the IE protein-containing deletions within this region were generated and assayed for transactivation function in transient transfection assays. These assays demonstrated that mutation of any acidic residue, either singly or in combination, or deletion of the carboxyl terminus of the IE protein resulted in a severe impairment of transactivation activity. These results show that both acidic and hydrophobic residues within the IE TAD are critical for transactivation function and that the carboxyl terminus of the IE protein is required for full transactivation activity.

The unique IR2 protein of equine herpesvirus 1 negatively regulates viral gene expression.

ABSTRACT The IR2 protein (IR2P) is a truncated form of the immediate-early protein (IEP) lacking the essential acidic transcriptional activation domain (TAD) and serine-rich tract and yet retaining binding domains for DNA and TFIIB and nuclear localization signal (NLS). Analysis of the IR2 promoter indicated that the IR2 promoter was upregulated by the EICP0P. The IR2P was first detected in the nucleus at 5 h postinfection in equine herpesvirus 1 (EHV-1)-infected HeLa and equine NBL6 cells. Transient-transfection assays revealed that (i) the IR2P by itself downregulated EHV-1 early promoters (EICP0, TK, EICP22, and EICP27) in a dose-dependent manner; (ii) the IR2P abrogated the IEP and the EICP27P (UL5) mediated transactivation of viral promoters in a dose-dependent manner; and (iii) the IR2P, like the IEP itself, also downregulated the IE promoter, indicating that the IEP TAD is not necessary to downregulate the IE promoter. In vitro interaction assays revealed that the IR2P interacts with TATA box-binding protein (TBP). The essential domain(s) of the IR2P that mediate negative regulation were mapped to amino acid residues 1 to 706, indicating that the DNA-binding domain and the NLS of the IR2P may be important for the downregulation. In transient-transfection and virus growth assays, the IR2P reduced EHV-1 production by 23-fold compared to virus titers achieved in cells transfected with the empty vector. Overall, these studies suggest that the IR2P downregulates viral gene expression by acting as a dominant-negative protein that blocks IEP-binding to viral promoters and/or squelching the limited supplies of TFIIB and TBP.

EHV-1 EICP22 protein sequences that mediate its physical interaction with the immediate-early protein are not sufficient to enhance the trans-activation activity of the IE protein

The early 293 amino acid EICP22 protein (EICP22P) of equine herpesvirus 1 localizes within the nucleus and functions as an accessory regulatory protein (J. Virol. 68 (1994) 4329). Transient transfection assays indicated that although the EICP22P by itself only minimally trans-activates EHV-1 promoters, the EICP22P functions synergistically with the immediate-early protein (IEP) to enhance expression of EHV-1 early genes (J. Virol. 71 (1997) 1004). We previously showed that the EICP22 protein enhances the DNA-binding activity of the EHV-1 IEP and that it also physically interacts with the IEP (J. Virol. 74 (2000) 1425). In this communication, we employed transient trans-activation assays utilizing EICP22P deletion mutants to address whether the sequences required for EICP22P-IEP physical interactions are essential for EICP22Ps ability to interact synergistically with the IEP. Assays employing various classes of the EHV-1 promoters fused to the chloramphenicol acetyl-transferase (CAT) reporter gene indicated that: (1) neither full length nor any of the EICP22P mutants tested was able to overcome repression of the IE promoter elicited by the IEP, (2) the full-length EICP22P interacted synergistically with the IEP to trans-activate the early and late promoters tested, and (3) all of the EICP22P mutants, including those that were able to physically interact with IEP and itself, failed to function synergistically with the IEP to trans-activate representative EHV-1 early and late promoters. The results suggest that EICP22P sequences required for its interaction with the IE protein are not sufficient to mediate its synergistic effect on the trans-activation function of the IEP. The possible explanations as to why sequences in addition to those that mediate EICP22P-IEP interaction and EICP22P self-interactions are essential for the synergistic function of EICP22P are discussed.

A Negative Regulatory Element (Base Pairs −204 to −177) of the EICP0 Promoter of Equine Herpesvirus 1 Abolishes the EICP0 Protein's trans-Activation of Its Own Promoter

ABSTRACT The early EICP0 protein is a powerful trans-activator that activates all classes of equine herpesvirus 1 (EHV-1) promoters but, unexpectedly, trans-activates its own promoter very weakly. Transient transfection assays that employed constructs harboring deletions within the EICP0 promoter indicated that EICP0 cis-acting sequences within bp −224 to −158 relative to the first ATG abolished the EICP0 proteins trans-activation of its own promoter. When inserted into the promoters of other EHV-1 genes, this sequence also downregulated activation of the immediate-early IE(−169/+73), early thymidine kinase TK(−215/+97), and late glycoprotein K gK(−83/+14) promoters, indicating that the cis-acting sequence (−224 to −158) downregulated expression of representative promoters of all classes of EHV-1 genes and contains a negative regulatory element (NRE). To define the cis-acting element(s), three synthetic oligonucleotides (Na [bp −224 to −195], Nb [bp −204 to −177], and Nc [bp −185 to −156]) were synthesized and cloned upstream of the EICP0(−157/−21) promoter. Of the three synthetic sequences, only the Nb oligonucleotide caused the downregulation of the EICP0 promoter. The NRE was identified as a 28-bp element to lie at −204 to −177 that encompassed the sequence of ([−204]AGATACAGATGTTCGATAAATTGGAACC[−177]). Gel shift assays performed with mouse L-M, rabbit RK-13, and human HeLa cell nuclear extracts and γ-32P-labeled wild-type and mutant NREs demonstrated that a ubiquitous nuclear protein(s) (NRE-binding protein, NREBP) binds specifically to a sequence (bp −193 to −183) in the NRE. The NREBP is also present in the nucleus of EHV-1-infected cells; however, the amount of NREBP in EHV-1-infected L-M cells that bound to the Nb oligonucleotide was reduced compared to that in uninfected L-M cells. Transient transfection assays showed that deletions or mutations within the NREBP-binding site abolished the NRE activity of the EICP0 promoter. These results suggested that the NREBP may mediate the NRE activity of the EICP0 promoter and may function in the coordinate expression of EHV-1 genes.

The EHV-1 UL4 protein that tempers viral gene expression interacts with cellular transcription factors

The UL4 gene is conserved within the genome of defective interfering particles of equine herpesvirus type 1 (EHV-1) that mediate persistent infection. Here, we show that the UL4 protein inhibits EHV-1 reporter gene expression by decreasing the level of transcribed mRNA. The UL4 protein did not bind any gene class of EHV-1 promoters in electromobility or chromatin immunoprecipitation assays, but directly interacted with the TATA box-binding protein (TBP) and the carboxy-terminal domain of RNA polymerase II both in vitro (GST-pulldown assays) and in infected cells (coimmunoprecipitation analyses). Microarray analyses of the expression of the 78 EHV-1 genes revealed that viral late genes important for virion assembly displayed enhanced expression in cells infected with UL4-null virus as compared to wild-type or UL4-restored EHV-1. Quantitative PCR analyses showed that viral DNA replication was not retarded in cells infected with the UL4-null virus as compared to wild-type EHV-1.

Comparative Genomic Sequencing and Pathogenic Properties of Equine Herpesvirus 1 KyA and RacL11

Equine herpesvirus 1 (EHV-1) is a major pathogen affecting equines worldwide. The virus causes respiratory disease, abortion, and, in some cases, neurological disease. EHV-1 Kentucky A (KyA) is attenuated in the mouse and equine, whereas wild-type pathogenic strain RacL11 induces severe inflammatory infiltration of the lung, causing infected mice to succumb. The complete DNA sequencing of the KyA genome revealed that genes UL17 (ORF17), US6 (ORF73; gI), US7 (ORF74; gE), and US8 (ORF75; 10 K) are deleted as compared to the RacL11 and Ab4 genomes. In-frame deletions in the US1 (ORF68), US4 (ORF71; gp2), and UL63 (ORF63; EICP0) genes and point mutations in 14 different open reading frames (ORFs) were detected in the KyA genome. Interestingly, UL1 (ORF1) and UL2 (ORF2) were deleted in both KyA and RacL11. Our previous studies showed that EHV-1 glycoproteins gI, gE, and full-length gp2 contribute to the pathogenesis of the RacL11 strain. The confirmation of these gene deletions in KyA suggests their contribution to the attenuation of this virus. The growth kinetics results revealed that KyA replicates to high titers in cell culture as compared to RacL11 and Ab4, indicating that the above genomic deletions and mutations in KyA do not have an inhibitory effect on KyA replication in cells of mouse, rabbit, equine, or human origin. Studies of EHV-1 pathogenesis in CBA mice showed that KyA is attenuated whereas mice infected with RacL11 succumbed by 3–6 days post-infection, which is consistent with our previous results.