Simon Easteal

Identification, characterization, and crystal structure of the Omega class glutathione transferases.

A new class of glutathione transferases has been discovered by analysis of the expressed sequence tag data base and sequence alignment. Glutathione S-transferases (GSTs) of the new class, named Omega, exist in several mammalian species andCaenorhabditis elegans. In humans, GSTO 1-1 is expressed in most tissues and exhibits glutathione-dependent thiol transferase and dehydroascorbate reductase activities characteristic of the glutaredoxins. The structure of GSTO 1-1 has been determined at 2.0-Å resolution and has a characteristic GST fold (Protein Data Bank entry code 1eem). The Omega class GSTs exhibit an unusual N-terminal extension that abuts the C terminus to form a novel structural unit. Unlike other mammalian GSTs, GSTO 1-1 appears to have an active site cysteine that can form a disulfide bond with glutathione.

A common nonsense mutation results in alpha-actinin-3 deficiency in the general population.

T he α-actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments 1. In humans, two genes (ACTN2 and ACTN3) encode the closely related α-actinin-2 and α-actinin-3 skeletal muscle iso-forms 2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres 3. We have previously demonstrated absence of α-actinin-3 in muscle biopsies from several patients with muscular dystrophy 3. A follow-up study identified additional α-actinin-3−negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness 4. Subsequently, we screened muscle specimens with dys-trophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a−d). Although these biopsies contained normal α-actinin-2 expression, deficiency of α-actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histo-pathological or clinical phenotype. To ascertain whether α-actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´–GATGGTTATGCAGCCCGAGG–3ánd 5´–AGCAACGCCCGCACCTCCT–3´) and AB8/AB1 (5´–TGCACGAAGCCTG-GACCC–3ánd 5´–AGAGAGGGATCTT-TATTCAG–3´), we PCR-amplified two overlapping fragments encompassing bases 24−2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of α-actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an A→G transition at nt 1,586 in exon 15, changing a gluta-mine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a C→T trans-version at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e−g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation. The R577X change creates a novel DdeI site (Fig. 1h). An additional 125 biopsies for which matched DNA samples were available were tested for α-actinin-3 expression and ACTN3 genotype (48 α-actinin-3−deficient and 77 α-actinin-3− positive biopsies with a mixture of histological and clinical …

Apolipoprotein E allele ∈4, dementia, and cognitive decline in a population sample

From clinically based series it has been proposed that, in homozygotes for the apolipoprotein E epsilon 4 (apoE epsilon 4) allele, Alzheimers disease is almost inevitable by the age of 80. A population sample of persons aged 70 years and over was interviewed in 1990-91 to ascertain the presence of dementia or cognitive impairment. The sample was reinterviewed in 1994, when the apoE genotype was also determined. Prevalence data for the 638 persons who completed the second examination revealed a linear association between having an apoE epsilon 4 allele and both dementia and cognitive impairment (for heterozygotes, odds ratio for dementia 1.89, 95% confidence interval 1.04-3.44 and for homozygotes OR 3.58, 95% CI 1.08-11.82; both adjusted for age). However, even in subjects homozygous for epsilon 4 the estimated prevalence of dementia by age 90 was only about 50%. Persons with one or two epsilon 4 alleles were more likely to have a family history of dementia than those with none. This study confirms in a population sample that the epsilon 4 allele is a risk factor for dementia, but refutes the suggestion that homozygosity for the epsilon 4 allele is sufficient for the development of Alzheimers disease: persons with either one or two epsilon 4 alleles may reach late old age without cognitive impairment.

A program for calculating and displaying compatibility matrices as an aid in determining reticulate evolution in molecular sequences

Reticulate evolution in molecular sequences is caused by recombination or gene conversion, and may interfere with the reconstruction of evolutionary history. This paper presents a program which calculates compatibility matrices for detecting reticulate evolution. In addition to visual inspection of matrices, they can be analysed statistically for clustering. The method is demonstrated using human and chimpanzee gamma-globin sequences.

Loss of ACTN3 gene function alters mouse muscle metabolism and shows evidence of positive selection in humans

More than a billion humans worldwide are predicted to be completely deficient in the fast skeletal muscle fiber protein α-actinin-3 owing to homozygosity for a premature stop codon polymorphism, R577X, in the ACTN3 gene. The R577X polymorphism is associated with elite athlete status and human muscle performance, suggesting that α-actinin-3 deficiency influences the function of fast muscle fibers. Here we show that loss of α-actinin-3 expression in a knockout mouse model results in a shift in muscle metabolism toward the more efficient aerobic pathway and an increase in intrinsic endurance performance. In addition, we demonstrate that the genomic region surrounding the 577X null allele shows low levels of genetic variation and recombination in individuals of European and East Asian descent, consistent with strong, recent positive selection. We propose that the 577X allele has been positively selected in some human populations owing to its effect on skeletal muscle metabolism.

Cohort Profile: The PATH through life project

Centre for Mental Health Research, Australian National University, Canberra, ACT, Australia, John Curtin School of Medical Research, Australian National University, Canberra, ACT, Australia, Orygen Youth Health Research Centre, Centre for Youth Mental Health, University of Melbourne, Melbourne, Victoria, Australia and Australian Demographic and Social Research Institute, Australian National University, Canberra, ACT, Australia

Memory complaints in a community sample aged 60–64 years: associations with cognitive functioning, psychiatric symptoms, medical conditions, APOE genotype, hippocampus and amygdala volumes, and white-matter hyperintensities

BACKGROUND Previous research has found that depression is a major cause of memory complaints. However, there is evidence that memory complaints also weakly predict cognitive decline and dementia. The present study examined a range of possible determinants of memory complaints, covering psychiatric and personality factors, medical history, cognitive test performance, and biological risk factors for dementia (APOE genotype, hippocampus and amygdala volumes, and white-matter hyperintensities). METHOD A community survey was carried out with 2546 persons aged 60-64 years living in Canberra and Queanbeyan, Australia. Participants were asked about memory problems which interfered with daily life and whether medical help had been sought. A randomly selected subsample of 476 persons was given a brain MRI scan. RESULTS Participants with memory complaints were found to have poorer memory test performance, more depression and anxiety symptoms, have higher scores on personality traits involving negative affect, and to have worse physical health. Multivariate analyses showed that measures of cognitive performance did not make a unique contribution to the prediction of memory complaints above that of the other categories of predictors. Those with memory complaints did not differ on any of the biological risk factors for dementia. CONCLUSION In a community sample aged 60-64 years, memory complaints were most closely related to psychiatric symptoms, personality characteristics and poor physical health. There was no evidence of brain changes indicating early dementia.

An association study of a functional polymorphism of the serotonin transporter gene with personality and psychiatric symptoms

A functional polymorphism in the regulatory region of the serotonin transporter gene has been reported to be associated with anxiety-related personality traits.1 We attempted to replicate this finding in an association study involving 759 Caucasians selected from the general Australian population. We found no associations with personality traits (including neuroticism, negative affect and behavioral inhibition), anxiety and depressive symptoms, or alcohol misuse.

APOE genotype and cognitive functioning in a large age-stratified population sample.

There is evidence that the cognitive effects of Alzheimers disease can be seen decades before disease diagnosis. If this is the case, then the apolipoprotein E (APOE) *E4 allele might be expected to have effects on cognitive functioning earlier in the life span. To assess such effects, the authors examined data on the *E4 allele and cognitive functioning from a population sample of 6,560 Caucasians covering the age groups of 20-24, 40-44, and 60-64 years. Participants were assessed on tests of episodic memory, working memory, mental speed, reaction time, and reading vocabulary. Although performance on all tests except reading vocabulary declined across age groups, there was no effect of the APOE *E4 allele at any age. These results indicate that APOE *E4 does not have preclinical effects early in the life span on these cognitive functions. Cognitive aging effects between the ages of 20 and 64 years must not be due to preclinical Alzheimers disease.

Association of smoking and personality with a polymorphism of the dopamine transporter gene: Results from a community survey

In studies that used mixed volunteer samples, Lerman et al. [1999: Health Psychol 18:14-20] and Sabol et al. [1999: Health Psychol 18:7-13] reported on an association of smoking with a polymorphism of the dopamine transporter gene. We attempted to replicate this association in a nonvolunteer community sample of 861 Caucasians. No associations were found with either smoking initiation or smoking cessation. Sabol et al. [1999] also reported on an association of the dopamine transporter polymorphism with the personality trait of novelty seeking. However, we failed to find any associations with a range of personality traits, including a scale of fun seeking that correlates with novelty seeking. These negative findings suggest that either the original associations are not replicable or that any association is very small.