Simone Engelender

Synphilin-1 associates with α-synuclein and promotes the formation of cytosolic inclusions

Parkinson disease (PD) is a neurodegenerative disease characterized by tremor, bradykinesia, rigidity and postural instability. Post-mortem examination shows loss of neurons and Lewy bodies, which are cytoplasmic eosinophilic inclusions, in the substantia nigra and other brain regions. A few families have PD caused by mutations (A53T or A30P) in the gene SNCA (encoding α-synuclein; refs 3, 4, 5). α-synuclein is present in Lewy bodies of patients with sporadic PD (Refs 6,7), suggesting that α-synuclein may be involved in the pathogenesis of PD. It is unknown how α-synuclein contributes to the cellular and biochemical mechanisms of PD, and its normal functions and biochemical properties are poorly understood. To determine the protein-interaction partners of α-synuclein, we performed a yeast two-hybrid screen. We identified a novel interacting protein, which we term synphilin-1 (encoded by the gene SNCAIP). We found that α-synuclein interacts in vivo with synphilin-1 in neurons. Co-transfection of both proteins (but not control proteins) in HEK 293 cells yields cytoplasmic eosinophilic inclusions.

Synphilin‐1 is present in Lewy bodies in Parkinson's disease

α‐Synuclein is believed to play an important role in Parkinsons disease (PD). Mutations in the α‐synuclein gene are responsible for familial forms of PD and α‐synuclein protein is a major component of Lewy bodies in patients with sporadic PD. Synphilin‐1 is a novel protein that we have previously found to associate in vivo with α‐synuclein. We now show that synphilin‐1 is present in Lewy bodies of patients with PD. Our data suggest that synphilin‐1 could play a role in Lewy body formation and the pathogenesis of PD. Ann Neurol 2000;47:521–523.

Immunocytochemical localization of synphilin-1, an α-synuclein-associated protein, in neurodegenerative disorders

Abstract. α-Synuclein is a major component of Lewy bodies (LB) in Parkinsons disease (PD) and dementia with LB (DLB), as well as of glial cytoplasmic inclusions (GCI) in multiple system atrophy (MSA). Recently, a novel protein called synphilin-1 has been identified that associates with α-synuclein, and it has been reported that co-transfection of both α-synuclein and synphilin-1 in mammalian cells yielded eosinophilic cytoplasmic inclusions resembling LB. Immunocytochemical and ultrastructural investigations have now been performed on the brain of patients with various neurodegenerative disorders using anti-synphilin-1 antibodies. These antibodies immunostained the neuropil in a punctate pattern throughout the brain of control subjects. In PD, most LB observed in the brain stem were positive for synphilin-1. These LB showed intense staining in their central cores, but their peripheral portions were only weakly stained or unstained. Pale bodies and Lewy neurites, which were positive for α-synuclein, were synphilin-1 negative. In DLB, a small fraction of cortical LB were immunolabeled by anti-synphilin-1. In MSA, numerous GCI were positive for synphilin-1. Immunoelectron microscopy revealed that the reaction product was localized within filamentous and circular structures in LB. Various neuronal and glial inclusions in neurodegenerative disorders other than LB disease and MSA were synphilin-1 negative. These findings suggest that abnormal accumulation of synphilin-1 is specific for brain lesions in which α-synuclein is a major component.

Huntington's disease and Dentatorubral-pallidoluysian atrophy: Proteins, pathogenesis and pathology

Each of the glutamine repeat neurodegenerative diseases has a particular pattern of pathology largely restricted to the CNS. However, there is considerable overlap among the regions affected, suggesting that the diseases share pathogenic mechanisms, presumably involving the glutamine repeats. We focus on Huntingtons disease (HD) and Dentatorubral‐pallidoluysian atrophy (DRPLA) as models for this family of diseases, since they have striking similarities and also notable differences in their clinical features and pathology. We review the pattern of pathology in adult and juvenile onset cases. Despite selective pathology, the disease genes and their protein products (huntingtin and atrophin‐1) are widely expressed. This presents a central problem for all the glutamine repeat diseases‐how do widely expressed gene products give rise to restricted pathology? The pathogenic effects are believed to occur via a “gain of function” mechanism at the protein level. Mechanisms of cell death may include excitotoxicity, metabolic toxicity, apop‐tosis, and free radical stress. Emerging data indicate that huntingtin and atrophin‐1 may have distinct protein interactions. The specific interaction partners may help explain the selective pathology of these diseases.

Pathogenesis of neurodegenerative diseases associated with expanded glutamine repeats: New answers, new questions

Eight diseases are now known to be caused by an expansion mutation of the trinucleotide repeat CAG encoding glutamine. Each disease is caused by a CAG expansion in a different gene, and the genes bear no similarity to each other except for the presence of the repeat. Nonetheless, the essential feature of all of these disorders is neurodegeneration in a set of overlapping cortical and subcortical regions. Disease age of onset, and in some cases severity, is correlated with repeat length. These and other observations have led to the hypothesis that CAG expansion causes disease by a toxic gain-of-function of the encoded stretch of polyglutamine residues. Expansion-induced abnormalities of cytoskeletal function or neuronal signalling processes may contribute to the pathogenic process. In addition, theoretical and experimental analysis of the chemistry of uninterrupted stretches of glutamine residues suggest that polyglutamine-containing proteins or protein fragments may aggregate, via a polar zipper, into beta pleated sheets. Recent findings have now established the presence of such aggregates in selected regions of brain from affected individuals, in transgenic mice expressing expanded repeats, and in isolated cells transfected with expanded repeats. The aggregates are most prominently manifest as neuronal intranuclear inclusion bodies. As the investigation of the link between these inclusions and cell dysfunction and death continues, it is possible that new avenues for therapeutic intervention will emerge.

Organization of the human synphilin-1 gene, a candidate for Parkinson's disease

We have recently identified a protein we called synphilin-1, which interacts in vivo with alpha-synuclein. Mutations in alpha-synuclein cause familial Parkinsons disease (PD). Alpha-synuclein protein is present in the pathologic lesions of familial and sporadic PD, and diffuse Lewy body disease, indicating an important pathogenic role for alpha-synuclein. Here we describe the structure of the human synphilin-1 gene (SNCAIP). The open reading frame of this gene is contained within ten exons. We have designed primers to amplify each SNCAIP exon, so these primers can now be used to screen for mutations or polymorphisms in patients with Parkinsons disease or related diseases. We found a highly polymorphic GT repeat within intron 5 of SNCAIP, suitable for linkage analysis of families with PD. We have mapped SNCAIP locus to Chromosome (Chr) 5q23.1-23.3 near markers WI-4673 and AFMB352XH5. In addition, using immunohistochemistry in human postmortem brain tissue, we found that synphilin-1 protein is present in neuropil, similar to alpha-synuclein protein. Because of its association with alpha-synuclein, synphilin-1 may be a candidate for involvement in Parkinsons disease or other related disorders.

Gene structure and map location of the murine homolog of the Huntington-associated protein, Hap1

Abstract. Huntingtons Disease (HD) is an inherited progressive neurodegenerative disorder associated with a mutation in a gene expressed in both affected and non-affected tissues. The selective neuropathology in HD is thought to be mediated in part through interactions with other proteins including the Huntington Associated Protein, HAP-1, which is predominantly expressed in the brain. We have mapped its murine homolog, Hap1, to mouse Chr 11 (band D), which shares extensive synteny with human Chr 17 including the region 17q21–q22, where the gene for `frontotemporal dementia and parkinsonism linked to chromosome 17 has bee mapped. In addition, we have sequenced a 21,984 base pair (bp) genomic clone encompassing the entire Hap1 gene. It is organized as 11 exons and flanked by exons from potentially one or more novel genes. At least three Hap1 transcripts (Hap1-A; Hap1-B; Hap1-C) can be formed by alternative splicing at the 3′ end of the gene leading to protein isoforms with novel C-termini.

Human huntingtin-associated protein (HAP-1) gene: genomic organisation and an intragenic polymorphism ☆

The huntingtin-associated protein (HAP-1) interacts with the Huntington disease gene product, huntingtin. It is predominantly expressed in the brain and shows an increased affinity for mutant huntingtin. We have sequenced an 18,656bp genomic region encompassing the entire human HAP-1 gene and determined its genomic organisation, with 11 exons spanning 12.1kb. We have also found an intragenic polymorphism within intron 6 of HAP-1. We have recently shown that HAP-1 maps to a region of the genome which has been implicated in a variety of neurological conditions, including progressive supranuclear palsy (PSP), a late-onset atypical parkinsonian disorder. The detailed characterisation of the genomic organisation of HAP-1 and the presence of an intragenic polymorphism will be helpful in evaluating its role in different disorders, using candidate gene approaches.

Chromosomal localization of the Huntingtin associated protein (HAP-1) gene in mouse and humans with radiation hybrid and interspecific backcross mapping.

The Huntingtin Associated protein, HAP-1, is predominantly expressed in the brain, where it interacts with huntingtin, the protein product of the Huntington’s disease gene (Li et al. 1995). Its predominantly neuronal expression pattern in rat, mouse, human, and primates, together with its increased affinity for mutant huntingtin suggests that HAP-1 may play an important role in the pathogenesis of Huntington’s disease (Li et al. 1995, 1996, 1998; Page et al. 1998). In the mouse, HAP-1 is also expressed in the testis (Bertaux et al. 1998), and its presence during early embryogenesis suggests it could play an important role in neural development (Dragatsis et al. 1998). We recently described the cloning and complete sequence analysis of a 21,984 base pair (bp) genomic region, encompassing Hap1, the murine homolog of the human HAP-1 gene (Nasir et al. 1998). We also demonstrated that Hap1 maps to Chr 11 (band D) by fluorescence in situ hybridization (FISH). A number of potentially interesting neurological mutations map to the distal portion of mouse Chr 11, including band D (Watkins-Chow et al. 1996). Here, using the Jackson Laboratory BSS cross [C57BL/ 6JEi × SPRET/Ei)F1 × SPRET/Ei] (Rowe et al. 1994) mapping panel, we have mapped Hap1close to three mutations ( cod, js, tn) associated with a neurological phenotype in mice, by PCR. The primers mhap1 (GACAAGGATGCTGGGAAGAA) and mhap2 (TCCTGGGTCCAGGTACATTC) were selected from our recently published (Nasir et al. 1998) mouse Hap1 genomic sequence. The ability of these primers to generate a unique PCR product for each of the parental strains C57BL/6J (B) [approximately 230 bp] andM. spretus(S) [approximately 220 bp] allowed us to genotype the entire panel of 94 animals (Rowe et al. 1994). The murineHap1 gene maps cleanly to the distal portion of Chr 11, 61 cM from the centromere, and cosegregates with a number of previously mapped loci including Brcal, Gast, and Mdc (Fig. 1). Three mouse mutations ( cod, js, tn) associated with neurological phenotypes map distal to Hap1 and close to the tip of the chromosome at positions 74, 77, and 79 cM from the centromere, respectively (Watkins-Chow et al. 1996; Fig. 1). We have also mapped the human HAP-1 gene to 17q21.2-21.3 by radiation hybrid (RH) mapping using the PCR primers ACCCAGTTCCTCTCGGAAGC (sense strand) and CGAATTGTCGGGCATAGACC (antisense strand), corresponding to the first predicted exon of the gene (Nasir et al. 1998). Briefly, DNA from each of the 93 cell lines was used as a PCR template. With standard PCR conditions and protocols, the finished reaction was assayed by agarose gel electrophoresis for the presence or absence of the PCR product. Data from each cell line was submitted to the Whitehead/MIT server (http://www.genome.wi.mit.edu) and compared with the framework maps (Hudson et al. 1995). The maximum resolution possible with these data is 1000 kb. The human HAP-1 gene maps within a 2-cM region of 17q21, flanked by the markers D17S800 and D17S791 (Fig. 2). The nearest framework marker WI-9005 is 3.36 centiRays (cR) from HAP-1, representing a distance of less than 1 megabase and a corresponding LOD score of greater than 3.0. WI-6595, another framework marker, is 9.5 cR away in the opposite direction. Progressive supranuclear palsy (PSP), an adult-onset atypical Parkinsonian disorder characterized by supranuclear vertical gaze palsy, postural instability, rigidity, and dementia (Ohara et al. 1992; de Yébenes et al. 1995) also maps to this region. It is in linkage disequilibrium with MAPT (Conrad et al. 1997; Higgins et al. 1998), which is found within the same 2-cM genetic interval as HAP-1 (Foster et al. 1997), but is involved in a different neuro* Present address:Human Genetics Unit, Molecular Medicine Centre, Western General Hospital, Edinburgh, EH4 2XU, UK