Soo-Young Jeon

Development of a classification system for extrinsic hair damage: standard grading of electron microscopic findings of damaged hairs.

Human hairs experience damage and restoration processes consistently because of various external and internal factors. To analyze degrees of hair damage, morphological studies based on electron microscopy (EM), and biochemical studies based on protein and lipid analysis have been proposed and are widely used. Among them, morphological analysis through EM is a fundamental method in understanding the degree of damage and restoration. EM has been very useful in assessing extrinsic and intrinsic damage of hair and various pathological alopecias and also in estimating the efficacy of various kinds of products related to hair care. However, morphological studies have some limitations because they have been described using varying terms and subjective descriptions by different researchers. To establish an objective classification of damaged hair using uniform terms and standardizations. We analyzed over 2000 scanning electron microscopic and transmission electron microscopic findings of normal and of various kinds of damaged hairs to develop a standard grading system for the damaged hairs. After reviewing the results of the electron microscopic pictures, we proposed a standard grading system based on scanning electron microscope and transmission electron microscope. We developed and proposed an easy, objective, and useful standard grading system of damaged hairs.

Antinuclear antibodies in patients with prurigo pigmentosa: a linkage or a coincidence?

Laboratory tests were within normal limits except for elevated ANA (1: 320, homogenous pattern), IgE ( 1 1,000 IU/ml) and eosinophil count (760 ! 10 6 /l). Other laboratory findings related to autoimmunity [anti-SS-A(Ro), anti-SS-A(La), ds-DNA antibodies] were negative. A skin biopsy showed marked spongiosis, exocytosis of neutrophils, blurring of dermoepidermal junctions, and superficial perivascular and interstitial lymphocytic infiltration ( fig. 2 a). Direct immunofluorescences (DIFs) were all negative. All of the features were consistent with PP. Daily treatment with 100 mg of doxycycline and 50 mg of dapsone was started. After 2 weeks, almost all of the lesions had been resolved leaving hyperpigmentation. The second patient was a 15-year-old female who presented with a 3-week history of a pruritic, erythematous eruption in the intermammary region and on the back ( fig. 1 b). She had been intermittently treated with topical corticosteroids for atopic dermatitis. Laboratory findings showed elevated ANA (1: 320, speckled pattern) and IgE (934 IU/ml). Additional laboratory findings related to autoimmunity [anti-SS-A(Ro), anti-SS-A(La), ds-DNA, anti-Sm antibodies] were negative. Histopathologic features showed intraepidermal blister, spongiosis, marked exocytosis, vacuolar alteration at the dermoepidermal junction and superficial perivascular lymphocytic infiltration ( fig. 2 b). DIFs were all negative. After the diagnosis of PP, treatment with 8 mg of methylprednisolone and 0.05% desonide lotion induced a dramatic response. The last patient was a 16-year-old female with a 3-week history of pruritic vesicular skin lesion on her back ( fig. 1 c). We performed a Tzanck smear from vesicular lesions, but it was negative. Laboratory findings showed elevated ANA (1: 80, homogenous pattern) and IgE (139 IU/ml), and other laboratory findings including autoimmunity [anti-SS-A(Ro), anti-SS-A(La), ds-DNA, anti-Sm antibodies] were within normal limits or negative. Histopathologic features were consistent with PP ( fig. 2 c), and DIFs were all negative. She was treated with 20 mg of prednisolone and

A New Method for Investigation of the Hair Shaft: Hard X-Ray Microscopy with a 90-nm Spatial Resolution

Various methods have been used to investigate the hair shaft. In the ultrastructural hair field, scanning and transmission electron microscopies are widely used investigative methods, but they have some technical limitations. Recently, X-ray microscopes with sub-micron spatial resolution have emerged as useful instruments because they offer a unique opportunity to observe the interior of an undamaged sample in greater detail. In this report, we examined damaged hair shaft tips using hard X-ray microscopy with a 90 nm spatial resolution. The results of this study suggest that hard X-ray microscopy is an alternative investigative method for hair morphology studies.

The effect of proopiomelanocortin-derived peptides on the immune system of human hair follicles.

1 CACAGTGGCCTTATTGTCTC CAACCKGGATTGGATTGGAG 502 806 2 ATGCCTATAGTCCCAGGTAC GATGATGTTCGGCCTTGATG 254 297 3–4 CATGGTTTTGTTGTAGYTTGAG GTCRATATTGGGAGTCCTAGAA 455 532 5 ATCATTCAGCAGCCCATGTC AAGGGAAAATGTGGCTAGCA 515 186 6 AGCCATAGGTGTGAGCAGTT GCTYAGAAAAGGGAACCCTA 1241 496 7 GGGTTTCCTTCTAGTTATGG GGACTTACTGCCAAGATTTC 1149 1472 8 CTTCCTCAAGTAGCTAGAAC AGTGCTCATCAAACAGCTTG 1526 433 9 RATTTATGGCCTGCCTCTAG ACTTCTGGCYTCAAGCTCTC 296 206 10 GATCAGATACTGAGGTTGAAC GATGCAAATGCTCAAAACCTC 240 186

Does segmental lipodystrophy represent mosaicism of inherited lipodystrophy

To the Editor: Lipodystrophy is a rare, heterogeneous group of diseases characterized by the absence of subcutaneous fat over part of or the entire body surface. Lipodystrophy is classified into two main groups, acquiredor inherited,which in turn comprise four and three subgroups, respectively. Each type of lipodystrophy has a unique clinical appearance and underlying pathogenic mechanism (Table I). A 13-year-old female with a prominent loss of subcutaneous fat on the lateral side of her left lower limb presented to our dermatology clinic. The patient’s mother noticed the presence of a small, depressed area at the gluteal muscle region of the left lower limb since 6 months of age. As the patient grew, a further gradual loss of subcutaneous fat caused this depression to become more prominent and extend downward. The patient had no mental or physical developmental abnormalities or any remarkable medical history, such as febrile disease or abnormal medical or drug medication. In addition, there was no family history of lipodystrophy. Upon physical examination, the patient’s lipoatrophy extended from the gluteal fossa to the dorsal surface of her left foot without any other involvement. This skin distribution was segmental. The skin overlying the areas of lipoatrophy was brown, thin, smooth, and not sclerotic. Superficial veins and muscularity were prominent because of the loss of