Spencer B. Farr

Bacterial defenses against oxidative stress

Bacteria treated with low doses of oxidants such as hydrogen peroxide adapt to subsequent high doses of these oxidants by inducing the expression of numerous genes. The study of these genes and the roles they play in defending bacteria against oxidative damage has given general insights into what oxidants are hazardous to cells, what cell constituents are damaged by oxidants, and how cells sense and respond to oxidative stress.

The CAT-Tox (L) Assay: A Sensitive and Specific Measure of Stress-Induced Transcription in Transformed Human Liver Cells

Identifying and measuring the molecular mechanisms of toxicity is an important goal in hazard assessment. We have developed an assay in transformed human liver cells to simultaneously measure the transcriptional responses of 14 stress promoter- or response element-chloramphenicol acetyl transferase (CAT) fusion constructs that are stably integrated into the HepG2 cell line. This assay can measure a wide spectrum of stresses, both toxic and nontoxic, such as protein and protein biosynthesis perturbations, DNA damage, heavy metals, and planar aromatic hydrocarbons. We found that each promoter or response element can be induced by one or more of four chemicals that were tested in the assay. These results have been interpreted in light of the current models of action for each compound. The responses of this assay system can distinguish among compounds that are closely related in their structure and have been shown previously to elicit similar biological activities in simple assay systems. We have designated this technique the CAT-Tox (L)iver assay. It measures a broad range of cellular stresses and toxicants at levels that were comparable to or below those of established methods. The induction profiles generated using the CAT-Tox (L) assay can help to elucidate the molecular mechanisms by which chemicals exert their actions on human cells. These profiles can be indicative of both toxic and nontoxic processes that are occurring in the cell. We propose that this cellular stress assay can serve as a screen for a variety of substances at the molecular level.

Interaction of a redox‐sensitive DNA‐binding factor with the 5′‐flanking region of the micF gene in Escherichia coli

The product of the micF gene is an endogenous anti‐sense RNA which down‐regulates the expression of a major outer membrane protein, OmpF, in E. coli. We report here that two DNA‐binding factors compete for the same site in the promoter region of the micF gene: RSBF, a high‐affinity redox‐sensitive DNA‐binding factor that responds to an active oxygen species other than hydrogen peroxide or superoxide anions; and HRBF a heat‐resistant DNA‐binding factor. Both RSBF and HRBF bind to the same DNA sequence, 5′‐TTAAAATCAATAACTTATTCTTAA3‐′, located upstream of the transcription start site of the micF gene. We present evidence that RSBF could be the controlling factor of a novel regulon involved in the response to oxidative stress in E. coli.