Stefan Pitsch

Molecular basis of RNA recognition by the human alternative splicing factor Fox‐1

The Fox‐1 protein regulates alternative splicing of tissue‐specific exons by binding to GCAUG elements. Here, we report the solution structure of the Fox‐1 RNA binding domain (RBD) in complex with UGCAUGU. The last three nucleotides, UGU, are recognized in a canonical way by the four‐stranded β‐sheet of the RBD. In contrast, the first four nucleotides, UGCA, are bound by two loops of the protein in an unprecedented manner. Nucleotides U1, G2, and C3 are wrapped around a single phenylalanine, while G2 and A4 form a base‐pair. This novel RNA binding site is independent from the β‐sheet binding interface. Surface plasmon resonance analyses were used to quantify the energetic contributions of electrostatic and hydrogen bond interactions to complex formation and support our structural findings. These results demonstrate the unusual molecular mechanism of sequence‐specific RNA recognition by Fox‐1, which is exceptional in its high affinity for a defined but short sequence element.

Mineral induced formation of sugar phosphates

Glycolaldehyde phosphate, sorbed from highly dilute, weakly alkaline solution into the interlayer of common expanding sheet structure metal hydroxide minerals, condenses extensively to racemic aldotetrose-2,4-diphosphates and aldohexose-2,4,6-triphosphates. The reaction proceeds mainly through racemic erythrose-2,4-phosphate, and terminates with a large fraction of racemic altrose-2,4,6-phosphate. In the absence of an inductive mineral phase, no detectable homogeneous reaction takes place in the concentration- and pH range used. The reactant glycolaldehyde phosphate is practically completely sorbed within an hour from solutions with concentrations as low as 50 µm; the half-time for conversion to hexose phosphates is of the order of two days at room temperature and pH 9.5. Total production of sugar phosphates in the mineral interlayer is largely independent of the glycolaldehyde phosphate concentration in the external solution, but is determined by the total amount of GAP offered for sorption up to the capacity of the mineral. In the presence of equimolar amounts of rac-glyceraldehyde-2-phosphate, but under otherwise similar conditions, aldopentose-2,4,-diphosphates also form, but only as a small fraction of the hexose-2,4,6-phosphates.

The Eight Stereoisomers of LNA (Locked Nucleic Acid): A Remarkable Family of Strong RNA Binding Molecules

The authors evaluated the RNA binding of all eight possible stereoisomers of LNA. Synthesis of qa-l-xylo-LNAq has been accomplished and the remaining four stereoisomers, all enantiomers of the four synthesized diastereoisomers, are indirectly evaluated by hybridization studies. The remarkable binding affinities and specificities obtained for LNA and a-l-LNA, both in a fully and in a partly modified context, establish these mols. as unique nucleic acid mimics. A strong impetus for this research has been, and continues to be, the therapeutic promises of the antisense strategy. [on SciFinder (R)]

Mineral induced formation of pentose-2,4-bisphosphates

Formation of rac.-pentose-2,4-bisphosphates is demonstrated, starting from glycolaldehyde phosphate and glyceraldehyde-2-phosphate, and induced by mixed valence double layer metal hydroxide minerals. The reactions proceed from dilute aqueous reactant solutions (1.5 mM) at near neutral pH. Conditions have been established, where ribose-2,4- bisphosphate is the major product (∼48%) among the pentose-2,4-bisphosphates, which are formed with up to 25% yield.

Selectivity of montmorillonite catalyzed prebiotic reactions of D, L-nucleotides

The montmorillonite-catalyzed reactions of the 5′-phosphorimidazolides of D, L-adenosine (D, L-ImpA) (Figure 1a. N = A, R = H) and D, L-uridine (Figure 1a., N = U, R = H) yields oligomers that were as long as 7 mers and 6 mers, respectively. The reactions of dilute solutions of D-ImpA and D-ImpU under the same conditions gave oligomers as long as 9 and 8 mers respectively. This demonstrated that oligomer formation is only partially inhibited by incorporation of both the D- and L-enantiomers. The structures of the dimers, trimers and tetramer fractions formed from D, L-ImpA was investigated by selective enzymatic hydrolysis, comparison with authentic samples and mass spectrometry. Homochiral products were present in greater amounts than would be expected if theoretical amounts of each were formed. The ratio of the proportion of homochiral products to that of the amount of each expected for the dimers (cyclic and linear), trimers and tetramers, was 1.3, 1.6, and 2.1, respectively. In the D, L-ImpU reaction homochiral products did not predominate with ratios of dimers (cyclic and linear), trimers and tetramers 0.8, 0.44, and 1.4, respectively. The proportions of cyclic dimers in the dimer fraction were 52–66% with D, L-ImpA and 44–69% with D, L-ImpU. No cyclic dimers were formed in the absence of montmorillonite. The differences in the reaction products of D, L-ImpA and D, L-ImpU are likely to be due to the difference in the orientations of the activated monomers when bound to the catalytic sites on montmorillonite. The consequences of the selectivity of montmorillonite as a prebiotic catalyst are discussed.

A caged uridine for the selective preparation of an RNA fold and determination of its refolding kinetics by real-time NMR.

The biological function of many RNAs is linked to a reversible conformational switching between active and inactive folds that differ in their secondary and/or tertiary structures. Regulatory RNAs, such as riboswitches, 3] and catalytic RNAs, such as ribozymes, undergo this conformational switching upon binding of metabolites or during catalysis. In general, the energetic differences between the alternative conformations are only small, and therefore the equilibrium distribution is strongly affected by ligand or substrate binding, or by small structural modifications, such as methylation of the nucleobases. Recently, we have introduced a method for studying the kinetics of RNA-conformational switching by time-resolved NMR spectroscopy. The method is based on RNA sequences modified with 1-(2-nitrophenyl)ethyl-substituted (NPE-substituted) nucleobases, which are designed to impair the formation of selected base pairs. When introduced at proper sequence position within the oligonucleotide fold, these photocleavable modifications lead to a specific destabilization of preselected folds. Rapid and traceless removal of the photolabile groups, carried out by coupling laser optics into the NMR tube, then allows NMR detection of the refolding process. The induced structural transition can be monitored from the time-dependent increase and decrease in intensity of imino proton resonances, which belong to specific base pairs present in specific folds. For medium-sized oligonucleotides, these resonances often show sufficient resolution in chemical shifts to be resolved in 1D experiments. In this context, we have already reported the refolding kinetics and a plausible refolding mechanism of the bistable 20-mer RNA sequence 5’-r[GACCGGAAGGUCCGCCUUCC]-3’. For this study, an (S)-NPE-substituted guanosine was introduced at position 6. The activation energy was Ea=26 kcalmol 1 and the frequency factor was A=10 s 1 for the forward process, or 31 kcalmol 1 and 10 s 1 for the backward process, respectively. These refolding rates are surprisingly low compared to the folding of similar systems from an unfolded state and are in agreement with a transient disruption of half of the base pairs. Together with an additional dynamical characterization by comparative water-exchange experiments, an associative mechanism was deduced, in which refolding is initiated by base-pair contacts between previously unpaired nucleotides. In this communication, we extend our real-time-NMR investigation of RNA secondary structural transitions to another bistable, 20-mer RNA sequence 5’-r(GAAGGGCAACCUUCGGGUUG)-3’ that was designed by Hçbartner et al. This RNA sequence adopts two almost equally stable hairpin folds A and B, each consisting of a five-base-pair stem, a stable tetraloop and six unpaired nucleotides (Figure 1C, D). In order to selectively destabilize fold B, we introduced an (R)-NPE-protected uridine at position U18 (Figure 1B). Structural and kinetic characterization were carried out by analyzing the imino proton NMR signals, each representing a specific base pair. The unmodified sequence shows 12 signals in the iminoproton region (Figure 1D), which were assigned to the base pairs of the two coexisting folds A and B by H,H-NOESY experiments. The signals assigned to fold A agreed well with the signals of the corresponding truncated 15-mer RNA hairpin (Figure 1A). After introduction of the (R)-NPE-protected U18 into the 20-mer RNA sequence, only the set of six imino proton signals characteristic of fold A were detected (Figure 1B). Importantly, this single NPE-modification completely suppressed the formation of fold B by preventing the formation of the associated U18–A9 base pair. Removal of the NPE group by photolysis and equilibration resulted in a NMR spectrum (Figure 1C) that was practically identical to the spectrum of the parent sequence (Figure 1D). To determine the kinetic parameters for refolding, the NPE group was released by a short continuous-wave laser pulse (duration 1.5 s) guided by an optical fibre into the NMR tube. Relaxation of the system towards equilibrium was monitored by the subsequent recording of 1D H spectra. 11] The refolding rate constants were obtained by fitting the time-dependent intensities of two selected pairs of imino proton signals according to the equation for a reversible first-order process (Figure 2A–D). The independently determined equilibrium constant KA!B was employed as an additional fit parameter. The thermodynamic parameters DHA!B=1.6 0.3 kcalmol 1 and DSA!B=6.0 1.0 calmol K 1 were determined from the temperature dependence of these K values (Figure S1 in the Supporting Information). The directly determined rate constants kA!B ranged between 0.005 0.001 s 1 at 283 K and 0.091 0.020 s 1 at 298 K; the rate constants kB!A were calculated from the kA!B and K values, and ranged between 0.005 0.002 s 1 at 283 K and 0.076 0.020 s 1 at 298 K. In each experiment, rates that were identical within the error range were determined for the two independently analyzed pairs of imino proton signals (all rates are given in Figure S2 in the Supporting Information). Arrhenius analysis revealed an activation energy of Ea,A!B=32.7 3.0 kcalmol 1 (Ea,B!A=31.0 [a] P. Wenter, A. Hainard, Prof. Dr. S. Pitsch Laboratory of Nucleic Acid Chemistry Ecole Polyt!chnique F!d!rale de Lausanne (EPFL) 1015 Lausanne (Switzerland) Fax: (+41)21-693-9355 E-mail : stefan.pitsch@epfl.ch [b] B. F6rtig, Prof. Dr. H. Schwalbe Johann Wolfgang Goethe University Institute for Organic Chemistry and Chemical Biology Center for Biomolecular Magnetic Resonance Marie-Curie Strasse 11, Frankfurt, 60439 Frankfurt/Main (Germany) Fax: (+49)69-7982-9515 E-mail : schwalbe@nmr.uni-frankfurt.de Supporting information for this article is available on the WWW under http://www.chembiochem.org or from the author.

Homochiral selection in the montmorillonite-catalyzed and uncatalyzed Prebiotic synthesis of RNA

The reaction of D,L-5′-activated nucleotide of adenosine in the presence and absence of montmorillonite gave 60∶40 and 96∶4 ratios, respectively of the D,D- and L,L∶D,L- and L,D-dimers.

Short, synthetic and selectively 13C-labeled RNA sequences for the NMR structure determination of protein–RNA complexes

We report an optimized synthesis of all canonical 2′-O-TOM protected ribonucleoside phosphoramidites and solid supports containing [13C5]-labeled ribose moieties, their sequence-specific introduction into very short RNA sequences and their use for the structure determination of two protein–RNA complexes. These specifically labeled sequences facilitate RNA resonance assignments and are essential to assign a high number of sugar–sugar and intermolecular NOEs, which ultimately improve the precision and accuracy of the resulting structures. This labeling strategy is particularly useful for the study of protein–RNA complexes with single-stranded RNA in solution, which is rapidly an increasingly relevant research area in biology.

NMR-spectroscopic characterization of phosphodiester bond cleavage catalyzed by the minimal hammerhead ribozyme

In order to relate the conformational dynamics of the hammerhead ribozyme to its biological function the cleavage reaction catalyzed by the hammerhead ribozyme was monitored by time-resolved nuclear magnetic resonance (NMR) spectroscopy. For this purpose, the two nucleosides around the scissile phosphodiester bond were selectively 13C labelled in multi-step organic syntheses starting from uniformly 13C-labelled glucose. The phosphoamidites were incorporated using phosphoamidite chemistry in the hammerhead substrate strand. In addition, the 2’-OH group on the 5’-side of the hammerhead substrate strand was labelled with a photolabile protecting group. This labelling strategy enabled a detailed characterisation of the nucleotides around the scissile phosphodiester bond in the ground state conformation of the hammerhead ribozyme in the absence and presence of Mg2+ ions as well as of the product state. Photochemical induction of the reaction in situ was further characterized by time-resolved NMR spectroscopy. The detailed structural and dynamic investigations revealed that the conformation of the hammerhead ribozyme is significantly affected by addition of Mg2+ leading to an ensemble of conformations where dynamic transitions between energetically similar conformations occur on the ms-timescale in the presence of Mg2+. The dynamic transitions are localized around the catalytic core. Cleavage from this ensemble cannot be described by mono-exponential kinetics but follows bi-exponential kinetics. A model is described to take into account these experimental data.

Probing mechanism and transition state of RNA refolding.

Kinetics and the atomic detail of RNA refolding are only poorly understood. It has been proposed that conformations with transient base pairing interaction are populated during RNA refolding, but a detailed description of those states is lacking. By NMR and CD spectroscopy, we examined the refolding of a bistable RNA and the influence of urea, Mg(2+), and spermidine on its refolding kinetics. The bistable RNA serves as a model system and exhibits two almost equally stable ground-state conformations. We designed a photolabile caged RNA to selectively stabilize one of the two ground-state conformations and trigger RNA refolding by in situ light irradiation in the NMR spectrometer. We can show that the refolding kinetics of the bistable RNA is modulated by urea, Mg(2+), and spermidine by different mechanisms. From a statistical analysis based on elementary rate constants, we deduce the required number of base pairs that need to be destabilized during the refolding transition and propose a model for the transition state of the folding reaction.