Subramanyam Ragupathy

Testing plant barcoding in a sister species complex of pantropical Acacia (Mimosoideae, Fabaceae)

Acacia species are quite difficult to differentiate using morphological characters. Routine identification of Acacia samples is important in order to distinguish invasive species from rare species or those of economic importance, particularly in the forest industry. The genus Acacia is quite abundant and diverse comprising approximately 1355 species, which is currently divided into three subgenera: subg. Acacia (c. 161 species), subg. Aculiferum (c. 235 species), and subg. Phyllodineae (c. 960 species). It would be prudent to utilize DNA barcoding in the accurate and efficient identification of acacias. The objective of this research is to test barcoding in discriminating multiple populations among a sister‐species complex in pantropical Acacia subg. Acacia, across three continents. Based on previous research, we chose three cpDNA regions (rbcL, trnH‐psbA and matK). Our results show that all three regions (rbcL, matK and trnH‐psbA) can distinguish and support the newly proposed genera of Vachellia Wight & Arn. from Acacia Mill., discriminate sister species within either genera and differentiate biogeographical patterns among populations from India, Africa and Australia. A morphometric analysis confirmed the cryptic nature of these sister species and the limitations of a classification based on phenetic data. These results support the claim that DNA barcoding is a powerful tool for taxonomy and biogeography with utility for identifying cryptic species, biogeograhic patterns and resolving classifications at the rank of genera and species.

Consensus of the 'Malasars' traditional aboriginal knowledge of medicinal plants in the Velliangiri holy hills, India

There are many vanishing cultures that possess a wealth of knowledge on the medicinal utility of plants. The Malasars of Dravidian Tamils are an indigenous society occupying the forests of the Western Ghats, South India. They are known to be exceptional healers and keepers of traditional aboriginal knowledge (TAK) of the flora in the Velliangiri holy hills. In fact, their expertise is well known throughout India as evidenced by the thousands of pilgrims that go to the Velliangiri holy hills for healing every year. Our research is the first detailed study of medicinal plants in India that considers variation in TAK among informants using a quantitative consensus analysis. A total of 95 species belonging to 50 families were identified for medicinal and general health purposes. For each species the botanical name, family, local name, parts used, summary of mode of preparation, administration and curing are provided. The consensus analysis revealed a high level of agreement among the informants usage of a particular plant at a local scale. The average consensus index value of an informant was FIC > 0.71, and over 0.80 for some ailments such as respiratory and jaundice. Some of the more common problems faced by the Malasars were gastrointestinal disorders, respiratory illness, dermatological problems and simple illness such as fever, cough, cold, wounds and bites from poisonous animals. We also discovered several new ethnotaxa that have considerable medicinal utility. This study supports claims that the Malasars possess a rich TAK of medicinal plants and that many aboriginals and mainstream people (pilgrims) utilize medicinal plants of the Velliangiri holy hills. Unfortunately, the younger generation of Malasars are not embracing TAK as they tend to migrate towards lucrative jobs in more developed urban areas. Our research sheds some light on a traditional culture that believes that a healthy lifestyle is founded on a healthy environment and we suggest that TAK such as that of the Malasars may serve toward a global lifestyle of health and environmental sustainability.

DNA barcoding discriminates a new cryptic grass species revealed in an ethnobotany study by the hill tribes of the Western Ghats in southern India

Our research brought together traditional aboriginal knowledge (TK) and scientific knowledge (SK) to explore the relationship between scientific and aboriginal systems of botanical classification and the corresponding valorization(s) of biological diversity in the Western Ghats of southern India. We worked with two aboriginal cultures namely ‘Irulas’ and ‘Malasars’ of the Nilgiri Biosphere Reserve with an objective of evaluating the ability of different knowledge systems (SK and TK) to distinguish grass species belonging to the genus Tripogon, and assess the ability of DNA barcoding to discriminate a new cryptic species ‘Tripogon cope’ as deciphered by the hill tribes. We discovered that the aboriginal informants identified a common ethnotaxa ‘Sunai pul’, which is a cryptic species of grass not recognized by the SK classification.sunai pul’ is very important to both aboriginal cultures with ritualistic and economic utility. Morphometric analysis confirms the cryptic nature of this new species, which was validated using DNA barcoding. DNA barcode regions matK and trnH‐psbA showed distinct sequence variations among the closely related ethnotaxa. Given the cryptic nature of ethnotaxa, we propose that a DNA barcode may be a reliable tool to identify ethnotaxa. We have initiated further studies in other cultures to develop theoretically sophisticated insights concerning the encounter between ‘local’ and ‘scientific’ approaches to the use of biodiversity knowledge. Furthermore, the research will add to a unifying global effort to speed up the documentation and understanding of the planets natural diversity, while simultaneously respecting the cultural heterogeneity as a vital component of biological diversity.

Valorizing the 'Irulas' traditional knowledge of medicinal plants in the Kodiakkarai Reserve Forest, India

A mounting body of critical research is raising the credibility of Traditional Knowledge (TK) in scientific studies. These studies have gained credibility because their claims are supported by methods that are repeatable and provide data for quantitative analyses that can be used to assess confidence in the results. The theoretical importance of our study is to test consensus (reliability/replicable) of TK within one ancient culture; the Irulas of the Kodiakkarai Reserve Forest (KRF), India. We calculated relative frequency (RF) and consensus factor (Fic) of TK from 120 Irulas informants knowledgeable of medicinal plants. Our research indicates a high consensus of the Irulas TK concerning medicinal plants. The Irulas revealed a diversity of plants that have medicinal and nutritional utility in their culture and specific ethnotaxa used to treat a variety of illnesses and promote general good health in their communities. Throughout history aboriginal people have been the custodians of bio-diversity and have sustained healthy life-styles in an environmentally sustainable manner. However this knowledge has not been transferred to modern society. We suggest this may be due to the asymmetry between scientific and TK, which demands a new approach that considers the assemblage of TK and scientific knowledge. A greater understanding of TK is beginning to emerge based on our research with both the Irulas and Malasars; they believe that a healthy lifestyle is founded on a healthy environment. These aboriginal groups chose to share this knowledge with society-at-large in order to promote a global lifestyle of health and environmental sustainability.

A botanical renaissance: state-of-the-art DNA bar coding facilitates an Automated Identification Technology system for plants

Traditional taxonomic practices are insufficient on their own to cope with the growing need for accurate identifications. The recent development of DNA barcoding has been applied to plants. The next step is the development of a high-throughput Automated Identification Technology (AIT) system. Our research indicates that the efficacy of an AIT system equates with savings in time and funding. Given the potential interconnectivity of web-based applications, we suggest an AIT system for plants that uses several existing systems and suggest several applications where AIT could serve as a tool for biologists and for society at large.

DNA Barcode Authentication of Wood Samples of Threatened and Commercial Timber Trees within the Tropical Dry Evergreen Forest of India

Background India is rich with biodiversity, which includes a large number of endemic, rare and threatened plant species. Previous studies have used DNA barcoding to inventory species for applications in biodiversity monitoring, conservation impact assessment, monitoring of illegal trading, authentication of traded medicinal plants etc. This is the first tropical dry evergreen forest (TDEF) barcode study in the World and the first attempt to assemble a reference barcode library for the trees of India as part of a larger project initiated by this research group. Methodology/Principal Findings We sampled 429 trees representing 143 tropical dry evergreen forest (TDEF) species, which included 16 threatened species. DNA barcoding was completed using rbcL and matK markers. The tiered approach (1st tier rbcL; 2nd tier matK) correctly identified 136 out of 143 species (95%). This high level of species resolution was largely due to the fact that the tree species were taxonomically diverse in the TDEF. Ability to resolve taxonomically diverse tree species of TDEF was comparable among the best match method, the phylogenetic method, and the characteristic attribute organization system method. Conclusions We demonstrated the utility of the TDEF reference barcode library to authenticate wood samples from timber operations in the TDEF. This pilot research study will enable more comprehensive surveys of the illegal timber trade of threatened species in the TDEF. This TDEF reference barcode library also contains trees that have medicinal properties, which could be used to monitor unsustainable and indiscriminate collection of plants from the wild for their medicinal value.

Local Knowledge and Conservation of Seagrasses in the Tamil Nadu State of India

Local knowledge systems are not considered in the conservation of fragile seagrass marine ecosystems. In fact, little is known about the utility of seagrasses in local coastal communities. This is intriguing given that some local communities rely on seagrasses to sustain their livelihoods and have relocated their villages to areas with a rich diversity and abundance of seagrasses. The purpose of this study is to assist in conservation efforts regarding seagrasses through identifying Traditional Ecological Knowledge (TEK) from local knowledge systems of seagrasses from 40 coastal communities along the eastern coast of India. We explore the assemblage of scientific and local traditional knowledge concerning the 1. classification of seagrasses (comparing scientific and traditional classification systems), 2. utility of seagrasses, 3. Traditional Ecological Knowledge (TEK) of seagrasses, and 4. current conservation efforts for seagrass ecosystems. Our results indicate that local knowledge systems consist of a complex classification of seagrass diversity that considers the role of seagrasses in the marine ecosystem. This fine-scaled ethno-classification gives rise to five times the number of taxa (10 species = 50 local ethnotaxa), each with a unique role in the ecosystem and utility within coastal communities, including the use of seagrasses for medicine (e.g., treatment of heart conditions, seasickness, etc.), food (nutritious seeds), fertilizer (nutrient rich biomass) and livestock feed (goats and sheep). Local communities are concerned about the loss of seagrass diversity and have considerable local knowledge that is valuable for conservation and restoration plans. This study serves as a case study example of the depth and breadth of local knowledge systems for a particular ecosystem that is in peril.Key words: local health and nutrition, traditional ecological knowledge (TEK), conservation and natural resources management, consensus, ethnomedicine, ethnotaxa, cultural heritage

Tripogon cope (Poaceae: Chloridoideae), a New Species Supported by Morphometric Analysis and a Synopsis of Tripogon in India

Abstract Tripogon cope Newmaster S. G., V. Balalasubramaniam, M. Murugesan, & S. Ragupathy a new species from South India, is described and illustrated. A key for the identification of all Indian Tripogon species is included. A detrended correspondence analysis identified 21 groups of taxa including the sp. novum from the 48 samples, analyzing 36 morphological characters. A discriminant function analysis was used to rigorously test the classification of specimens provided in the cluster analysis. This study provides preliminary evidence of morphometric variation within and among species of Tripogon, which allows further development of hypothesis concerning species boundaries. Discussions concerning ecological data and distribution are presented in the context of conservation initiatives of rare and endemic Tripogon taxa within India.

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it’s not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5′ CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3′) was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species’ ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

The Fine Scale Ethnotaxa Classification of Millets in Southern India

Abstract This research explores variation in minor millets in the context of traditional knowledge (TK) and scientific knowledge (SK), including ethnobotany genomics, in southern India. In order to perceive biodiversity, we need to take a closer look at the natural variation among species within the context of existing classifications using both TK and SK. Malayali informants of the Kolli Hills in India were surveyed using 174 millet samples. We also collected seeds and grew millets in greenhouse environments from which we recorded 96 morphological characters and extracted DNA for barcoding. Quantitative multivariate classification analysis of these plants revealed that the Malayali millet classification is hierarchical and recognizes considerable fine scale variation with high consensus. In the field, the Malayali classified and consistently identified 19 millet ethnotaxa (landraces). Variation in these same samples was analyzed using morphometric and molecular characters (DNA barcoding) but revealed fewer taxa. Some of the cryptic taxa identified by the Malayali, including a potentially drought tolerant millet ethnotaxa, have considerable nutritional, medicinal, and ecological value.