Supan Fucharoen

BCL11A is a major HbF quantitative trait locus in three different populations with β-hemoglobinopathies ☆

Increased HbF levels or F-cell (HbF containing erythrocyte) numbers can ameliorate the disease severity of beta-thalassemia major and sickle cell anemia. Recent genome-wide association studies reported that single nucleotide polymorphisms (SNPs) in BCL11A gene on chromosome 2p16.1 were correlated with F-cells among healthy northern Europeans, and HbF among Sardinians with beta-thalassemias. In this study, we showed that SNPs in BCL11A were associated with F-cell numbers in Chinese with beta-thalassemia trait, and with HbF levels in Thais with either beta-thalassemia or HbE trait and in African Americans with sickle cell anemia. Taken together, the data suggest that the functional motifs responsible for modulating F-cells and HbF levels reside within a 3 kb region in the second intron of BCL11A.

A simplified screening strategy for thalassaemia and haemoglobin E in rural communities in south-east Asia

OBJECTIVE To evaluate a simple screening strategy for thalassaemia and haemoglobin (Hb) E in a prevention and control programme for thalassaemia in rural communities with limited resources. METHODS Blood samples from 301 Thai-Khmer participants were screened for thalassaemia and Hb E using a combined modified one-tube osmotic fragility (OF) test and a modified dichlorophenolindophenol (DCIP) precipitation test. Results were evaluated with standard haematological analyses including erythrocyte indices, Hb typing and quantification and polymerase chain reaction (PCR) analysis of alpha-globin and beta-globin genes. FINDINGS Participants were divided into four groups according to the results of the combined tests. Altogether, 104 of 301 participants (34.6%) had negative results on both tests; 48 (15.9%) were positive on the OF test but not the DCIP test; 40 (13.3%) were negative on the OF test but positive on DCIP test; and 109 (36.2%) were positive on both tests. No carrier of clinically significant forms of thalassaemia (alpha(o)-thalassaemia, beta-thalassaemia) or Hb E was found among the group that had negative results for both tests. All participants with Hb E had positive DCIP tests. Carriers of alpha+-thalassaemia or Hb Constant Spring could generate either positive or negative OF test results but they all had negative DCIP tests. Using both tests as a preliminary screening for the three important groups of carriers gave a sensitivity of 100% and a specificity of 69.8%. The positive predictive value of the combined test was 77.2%. The negative predictive value was 100%. Further evaluation of the screening system by local staff at three community hospitals found a sensitivity of 98.1-100% and a specificity of 65.4-88.4% with positive predictive values of 75.0-86.9% and negative predictive values of 98.1-100%. CONCLUSION A combined test using OF and DCIP could be used as an effective preliminary screening alternative to an electronic blood cell count for identifying carriers with alpha(o)-thalassaemia, beta-thalassaemia and Hb E. The strategy should prove useful for population screening in prevention and control programmes in rural communities in south-east Asia where laboratory facilities and economic resources are limited.

Fetal hemoglobin in sickle cell anemia: genome-wide association studies suggest a regulatory region in the 5′ olfactory receptor gene cluster

In a genome-wide association study of 848 blacks with sickle cell anemia, we identified single nucleotide polymorphisms (SNPs) associated with fetal hemoglobin concentration. The most significant SNPs in a discovery sample were tested in a replication set of 305 blacks with sickle cell anemia and in subjects with hemoglobin E or beta thalassemia trait from Thailand and Hong Kong. A novel region on chromosome 11 containing olfactory receptor genes OR51B5 and OR51B6 was identified by 6 SNPs (lowest P = 4.7E-08) and validated in the replication set. An additional olfactory receptor gene, OR51B2, was identified by a novel SNP set enrichment analysis. Genome-wide association studies also validated a previously identified SNP (rs766432) in BCL11A, a gene known to affect fetal hemoglobin levels (P = 2.6E-21) and in Thailand and Hong Kong subjects. Elements within the olfactory receptor gene cluster might play a regulatory role in gamma-globin gene expression.

Molecular and hematologic features of hemoglobin E heterozygotes with different forms of α-thalassemia in Thailand

We describe the hematological and DNA characterization of hemoglobin (Hb) E heterozygote with various forms of α-thalassemia in Thai individuals. Altogether, 202 unrelated adult subjects with Hb E heterozygotes either with or without α-thalassemia determinant were studied. The most prevalent interaction was found to be a double heterozygote for Hb E/α-thalassemia 2, followed by a double Hb E/α-thalassemia 1 and a Hb E/Hb Constant Spring (CS), even though the Hb CS was not detected. Double heterozygotes for Hb E and homozygous α-thalassemia 2 and Hb E with a compound α-thalassemia 2/Hb CS were also encountered with lower frequencies. Unexpectedly, as many as 18 cases previously diagnosed as Hb E carriers at routine Hb analysis were indeed Hb E heterozygotes with compound α-thalassemia 1/α-thalassemia 2, indicating a need for globin genotyping for accurate diagnosis. A change in Hb E level was observed which was related to a concomitant inheritance of α-thalassemia. The hematological expression of these Hb E heterozygotes with various forms of α-thalassemia, including a hitherto undescribed condition of double heterozygosity for Hb E/Hb Paksé identified in two subjects, is presented comparatively with those of the 80 cases of pure Hb E carriers. A multiplex allele-specific polymerase chain reaction (PCR) assay for simultaneous detection of Hb E and Hb CS genes is also described.

Thalassemia in Thailand.

In Thailand, a and B thalassemia, hemoglobin (Hb) E, and Hb Constant Spring (Con Sp) are The frequencies are 20%-30% for a thalassemia, 3%-9% for thalassemia, up to 52% for Hb E and at least 4% for Hb Con Sp. The abnormal genes in different combinations lead to over 60 thalassemic syndromes. TABLE 1 shows the numbers of patients with major thalassemic diseases examined in our unit, exclusive of the Hb Barts hydrops fetalis. This is in the department of medicine; in the department of pediatrics of this hospital they have seen more or less the same numbers of thalassemic patients. Clinical features, although of extreme interest, will not be described here; however, certain other salient points will be discussed.

Mitochondrial DNA polymorphisms in Thailand.

AbstractNucleotide sequences of the D-loop region of human mitochondrial DNA from six small ethnic groups of Thailand i.e., Hill tribes (Lisu and Mussur), Phuthai, Lao Song, Chong, and aboriginal Sakai, were analyzed. The sequences were compared with those of native Thai populations from two provinces, Chiang Mai and Khon Kaen. Based on a comparison of the 563-bp sequences in 215 Thai individuals, 137 different sequence types were observed. Of these, 124 were unique to their respective populations, whereas 13 were shared between two to five populations. The intergenic COII/tRNALys 9-bp deletion was observed in every Thai population examined, except for the Sakai, with varying frequencies ranging from 18% to 40%. The D-loop sequences variation, and phylogenetic analysis, suggested that the 9-bp deletion had occurred in a very ancient ancestry of Southeast Asians, although multiple origins of the deletion cannot be ruled out. Genetic distances, based on net nucleotide diversities, between populations revealed that the Sakai were distantly related to the other Thai populations, while the Lao Song and Chong were closely related to each other. Close genetic affinities were also observed among the Hill tribes, Phuthai, and native northeast Thai (Khon Kaen), indicating that they may share some degree of the common ancestral maternal lineages.

A reliable screening protocol for thalassemia and hemoglobinopathies in pregnancy: an alternative approach to electronic blood cell counting.

Primary screening for thalassemia and hemoglobinopathies usually involves an accurate blood count using an expensive electronic blood cell counter A cheaper alternative method was tested by using a modified osmotic fragility (OF) test and a modified dichlorophenolindophenol (DCIP) test. Altogether 423 pregnant Thai women participated in this project. Hemoglobin patterns and globin genotypes were determined using an automated high-performance liquid chromatography analyzer and polymerase chain reaction analysis of alpha- and beta-globin genes. Among the 423 subjects, 264 (62.4%) carried thalassemia genes. The combined OF and DCIP tests detected all pregnant carriers of the 3 clinically important thalassemias, ie, alpha0-thalassemia, beta-thalassemia, and hemoglobin E with a sensitivity of 100.0%, specificity of 87.1%, positive predictive value of 84.5%, and negative predictive value of 100.0%, which show more effectiveness than these values for the standard method based on RBC counts. A combination of modified OF and DCIP tests should prove useful and applicable to prenatal screening programs for thalassemia and hemoglobinopathies in communities with limited facilities and economic resources.

The diverse molecular basis and hematological features of Hb H and AEBart's diseases in Northeast Thailand

We defined the molecular basis and correlated the hematological phenotypes with the globin genotypes in 52 patients with Hb H disease and 29 patients with AEBart’s disease of northeast Thailand. Among the former group, the most prevalent molecular defect was found to be the interaction of α-thalassemia 1 (SEA type) with the Hb Constant Spring (Hb CS; 35 of 52 patients), followed by the deletion of three α-globin genes with the SEA type α-thalassemia 1 and the 3.7- or 4.2-kb deletion of α-thalassemia 2 (14 of 52 patients) and the interaction of the SEA α-thalassemia 1 with the Hb Paksé which was found in the remaining 3 patients. Among the 29 patients of the latter group, in 18 disease was caused by interactions of Hb E heterozygotes with the SEA α-thalassemia 1 and Hb CS. Interaction of Hb E heterozygotes with a deletional form of Hb H disease was detected in 7 patients and the Hb Paksé AEBart’s disease was found in another 3 patients. A remaining patient with an unusually severe form of AEBart’s disease with a lower Hb E level and observable Hb H was associated with a hitherto undescribed condition, the interaction of Hb E heterozygote with α-thalassemia 1 and an α2 codon 30 (GAG) deletion. Hematological characterization of the patients demonstrated that although disease in most of them was associated with thalassemia intermedia phenotypes, it was apparent that association with the nondeletional form of α-thalassemia 2 produced a more severe phenotype than that of the deletional one. Therefore, α-globin gene analysis of Hb H and AEBart’s disease patients would be useful for predicting the clinical outcome and improving genetic counseling.

Rapid and simultaneous non‐radioactive method for detecting α‐thalassemia 1 (SEA type) and Hb Constant Spring genes

To the Editor: The Southeast Asia (SEA) r-thalassemia 1 gene deletion is the most common form of r-thalassemia that in homozygotes produces a fatal condition known as the Hb Bart’s hydrops fetalis syndrome, which also carried an increased risk of maternal complications (1). In addition, interaction of this gene deletion with the Hb Constant Spring (HbCS), an elongated hemoglobin characterized by a mutation in the r2-globin gene, is a major cause of HbH disease in Southeast Asia (1). Therefore, rapid and accurate detection of these two forms of a-thalassemia would be useful for carrier screening and prenatal diagnosis. Recently, PCR-based methods for the detection of the SEA type a-thalassemia gene deletion (2-4) and of the HbCS allele (5) have been described. While the former detected the SEA deletion by using primers flanking the deletion breakpoints, the latter applied the principle of allelespecific PCR. Although both methods are adequate and accurate for DNA analysis, they have been tedious and expensive. This is especially important in areas of high prevalence of r-thalassemia. Here we report a more rapid, simultaneous nonradioactive method for detection of these two common forms of a-thalassemia. Conditions were designed and tested so that both forms of r-thalassemia could be identified in a single amplification reaction. Fig. 1A depicts the five primers used in this approach. Primers A7 (5’ CTCTGTGTTCTCAGTATTGGAG 3’) and A9 (5’ ATATATGGGTCTGGAAGTGTATC 3‘) flanking the SEA deletion breakpoints were as described by Bowden et al. (2). The A1 B primer (5’ GGTTCCCTGAGCCCCGACACG 3’) for the amplification of normal fragment was as described by Chang et al. (3). These three primers were used for the detection of normal (3 14 bp) and SEA deletion (660 bp) alleles. The remaining two primers; r G 2 (5’ GCTGACCTCCAAATACCGTC 3’) and r G 4 (5’ GTAAACACCTCCATTGTTGG 3’) were used to produce the 191 bp fragment specific for the HbCS allele (5). The PCR reaction mixture (50 pl) contains 0.1 pg DNA, 15 pmol of each primer (A7, A9, AIB, a G 2 and rxG4), 200 pmol/l dNTPs, 1 unit Tuq DNA polymerase enzyme (Perkin Elmer Cetus) in 10 mmol/l Tris-HC1 pH 8.3, 50 mmol/l KCI, 1.5 mmol/l MgCI, and 0.01% gelatin. Glycerol was added to the final concentration of 10% to the reaction mixture, because we have found that it greatly improved the efficiency and specificity of the amplification. After heating to 94°C for 3 min, the PCR process (94°C 1 min, 55 “ C 1 min and 72°C 1 min) was carried out on a DNA Thermal Cycler 480 (Perkin Elmer Cetus instrument) for 30 cycles. Ten microliters of the amplified product was then analyzed on 1.5% agarose gel electrophoresis followed by ethidium bromide staining (0.5 pg/ml) before photography under UV light. Fig. 1B demonstrates the result of this analysis on 4 unrelated individuals whose genotypes are indicated. While a normal individual (lane 1) generated only one 3 14 bp fragment, the a-thalassemia 1 traits (lane 3, 4) had an additional band at 660 bp, due to the large DNA deletion in the region between A7 and A9 primers. The 191 bp fragment clearly indicates the presence of the HbCS allele in individuals 2 and 3, who had HbCS trait and HbH disease with HbCS, respectively. For those who were positive for the HbCS allele, the zygosity of the mutation could simply be determined by replacing the r G 1 normal primer (5’ GCTGACCTCCAAATACCGTT 3’) (5) for the aG2 in the PCR using the same condition. The result of this study demonstrates that both r-thalassemia 1 (SEA type) and HbCS genes were easily be detected by this assay. The accuracy and simplicity of this non-radioactive method should greatly facilitate carrier screening and prenatal diagnosis of the severe forms of a-thalasseniia in populations in which r-thalassemia is encountered at high frequency.

Hb Paksé [(alpha2) codon 142 (TAA-->TAT or Term-->Tyr)J in Thai patients with EAbart's disease and Hb H Disease.

Hb Paksé is caused by an α2-globin gene termination codon mutation, TA A→TA T or Term→Tyr, initially described in a Laotian family. We now report for the first time that the same mutation has been found in 14 Thai patients, seven with EABarts disease, four with Hb H disease, and three with α-thalassemia trait who were initially diagnosed as having Hb Constant Spring (Hb CS; α2-globin gene termination codon mutation T AA→C AA or Term→Gln). Co-inheritance of this mutation with α-thalassemia-1 (SEA type) leads to Hb H disease (hereafter designated as Hb H-Paksé disease) and to a complex thalassemia syndrome, namely EABarts-Paksé disease. Hematological data of these patients were compared with those of classical Hb H-CS and the EABarts patients. To facilitate epidemiological and diagnostic screening of Hb Paksé, a simple assay procedure based on allele specific polymerase chain reaction (PCR) amplifications was developed and validated. Using this allele specific PCR as a screening method, five additional individuals with Hb Paksé were found among 71 Thai subjects previously thought to have Hb CS.