Sylvie Reverchon

Characterization of the Erwinia chrysanthemi expI–expR locus directing the synthesis of two N-acyl-homoserine lactone signal molecules

The plant pathogen Erwinia chrysanthemi produces three acyl‐homoserine lactones (acyl‐HSLs). One has been identified as N‐(3‐oxohexanoyl)‐homoserine lactone (OHHL), and the two others were supposed to be N‐(hexanoyl)‐homoserine lactone (HHL) and N‐(decanoyl)‐homoserine lactone (DHL). The genes for a quorum‐sensing signal generator (expI ) and a response regulator (expR ) were cloned. These genes are convergently transcribed and display high similarity to the expI–expR genes of Erwinia carotovora. ExpI is responsible for both OHHL and HHL production. Inactivation of expI had little effect on pectinase synthesis in E. chrysanthemi, as expression of only two of the pectate lyase genes, pelA and pelB, was decreased. E. chrysanthemi expR mutants still produced acyl‐HSL and pectinases. However, gel shift and DNAse I footprinting experiments showed that the purified E. chrysanthemi ExpR protein binds specifically to the promoter regions of the five major pel genes. Addition of OHHL modified the ExpR‐DNA bandshift profiles, indicating that ExpR interacts with OHHL and binds to DNA in different ways, depending on the OHHL concentration. Localization of the ExpR binding sites just upstream of promoter regions suggests that ExpR functions as an activator of pel expression in the presence of OHHL. The absence of a phenotype in expR mutants strongly suggests that at least an additional interchangeable ExpR homologue exists in E. chrysanthemi. Finally, transcription of expI ::uidA and expR ::uidA fusions is dependent on the population density, suggesting the existence of a quorum‐sensing hierarchy in E. chrysanthemi. These results suggest that the expI–expR locus is part of a complex autoregulatory system that controls quorum sensing in E. chrysanthemi.

pecS: a locus controlling pectinase, cellulase and blue pigment production in Erwinia chrysanthemi

Erwinia chrysanthemi mutants (designated as pecS) displaying derepressed pectate lyase and cellulose synthesis were isolated. In addition, the pecS mutation is responsible for production of an extracellular insoluble blue pigment whose synthesis is cryptic in the wild‐type 3937 strain. Transduction analysis indicates that the phenotype is due to a single mutation located near the xyl marker on the strain 3937 chromosome. This mutation was complemented by an R‐prime plasmid carrying the xyl and argG genes of E. chrysanthemi, suggesting that the pecS product acts in trans to modulate pectinase, cellulase and blue pigment production. Insertion mutagenesis of the cloned region and recombination of the corresponding mutations in the bacterial chromosome by marker exchange revealed the existence of two divergently transcribed genes, pecS and pecM, that are both involved in the pectate lyase and cellulase regulation. The nucleotide sequences of pecS and pecM were determined. The pecS gene encodes a 166 amino acid polypeptide that shows similarity to the MprA regulatory protein of Escherichia coli whereas the pecM gene encodes a 297 amino acid polypeptide that was shown to be an integral membrane protein. The possible functions of the PecS and PecM proteins derived from the mutant phenotype and sequence analysis are discussed in terms of signal transduction and transcription regulation.

Characterization of Indigoidine Biosynthetic Genes in Erwinia chrysanthemi and Role of This Blue Pigment in Pathogenicity

In the plant-pathogenic bacterium Erwinia chrysanthemi production of pectate lyases, the main virulence determinant, is modulated by a complex network involving several regulatory proteins. One of these regulators, PecS, also controls the synthesis of a blue pigment identified as indigoidine. Since production of this pigment is cryptic in the wild-type strain, E. chrysanthemi ind mutants deficient in indigoidine synthesis were isolated by screening a library of Tn5-B21 insertions in a pecS mutant. These ind mutations were localized close to the regulatory pecS-pecM locus, immediately downstream of pecM. Sequence analysis of this DNA region revealed three open reading frames, indA, indB, and indC, involved in indigoidine biosynthesis. No specific function could be assigned to IndA. In contrast, IndB displays similarity to various phosphatases involved in antibiotic synthesis and IndC reveals significant homology with many nonribosomal peptide synthetases (NRPS). The IndC product contains an adenylation domain showing the signature sequence DAWCFGLI for glutamine recognition and an oxidation domain similar to that found in various thiazole-forming NRPS. These data suggest that glutamine is the precursor of indigoidine. We assume that indigoidine results from the condensation of two glutamine molecules that have been previously cyclized by intramolecular amide bond formation and then dehydrogenated. Expression of ind genes is strongly derepressed in the pecS background, indicating that PecS is the main regulator of this secondary metabolite synthesis. DNA band shift assays support a model whereby the PecS protein represses indA and indC expression by binding to indA and indC promoter regions. The regulatory link, via pecS, between indigoidine and virulence factor production led us to explore a potential role of indigoidine in E. chrysanthemi pathogenicity. Mutants impaired in indigoidine production were unable to cause systemic invasion of potted Saintpaulia ionantha. Moreover, indigoidine production conferred an increased resistance to oxidative stress, indicating that indigoidine may protect the bacteria against the reactive oxygen species generated during the plant defense response.

New synthetic analogues of N-acyl homoserine lactones as agonists or antagonists of transcriptional regulators involved in bacterial quorum sensing

A series of 22 novel synthetic N-acyl-homoserine lactone analogues has been evaluated for both their inducing activity and their ability to competitively inhibit the action of 3-oxo-hexanoyl-L-homoserine lactone, the natural inducer of bioluminescence in the bacterium Vibrio fischeri. In the newly synthesized analogues, the extremity of the acyl chain was modified by introducing ramified alkyl, cycloalkyl or aryl substituents at the C-4 position. Most of the analogues bearing either acyclic or cyclic alkyl substituents showed inducing activity. In contrast, the phenyl substituted analogues displayed significant antagonist activity. We hypothesized that the antagonist activity of the phenyl compounds may result from the interaction between the aryl group and aromatic amino acids of the LuxR receptor, preventing it from adopting the active dimeric form.

Characterization of kdgR, a gene of Erwinia chrysanthemi that regulates pectin degradation

Erwinia chrysanthemi is a phytopathogenic enterobacterium able to degrade the pectic fraction of plant cell walls. The kdgR negative regulatory gene controls all the genes involved in pectin catabolism, including the pel genes encoding pectate lyases. The E. chrysanthemi kdgR regulatory gene was subcloned in Escherichia coli where it was shown to be functional, since it repressed the expression of a pelE::uidA fusion. The nucleotide sequence of kdgR contained an open reading frame of 918bp preceded by classical transcriptional initiation signals. KdgR shows similarity to two other regulatory proteins, namely GylR, encoding an activator protein of the glycerol operon in Streptomyces coelicolor, and IclR, encoding a repressor of the acetate operon in Salmonella typhimurium and in Escherichia coli. Previously, comparison of regulatory regions of several genes controlled by kdgR revealed the existence of a conserved region which was proposed as a KdgR‐binding site. The 25 bp oligonucleotide AAAAAAGAAACATTG‐TTTCATTTGT corresponding to this consensus was substituted to the lac operator, at the beginning of transcription of the lacZ gene. This construct functioned as an operator for binding of the KdgR protein in vivo.

Integration of the quorum‐sensing system in the regulatory networks controlling virulence factor synthesis in Erwinia chrysanthemi

The expI–expR locus drives a quorum‐sensing system in the phytopathogenic bacterium, Erwinia chrysanthemi. Purified ExpR, an N‐acyl homoserine lactone‐responsive regulatory protein, binds to the promoter/operator region of the expI and expR genes. DNase I footprinting experiments showed that ExpR protects the regions between −66 and −40 from the P1 transcription initiation site of expI and between −54 and −18 from the expR transcription initiation site P1. The protected region overlaps the two expR promoters, P1 and P2, suggesting that ExpR exerts a negative control on its own gene expression. This assertion is reinforced by the fact that the addition of OHHL dissociates the ExpR–expR DNA complex. In contrast, the location of the ExpR binding site on the expI gene suggests an activator function, as reported for the pel genes. Moreover, ExpR is able to induce DNA bending. In vivo and in vitro studies revealed that CRP functions as an activator of expR expression, but as a repressor of expI transcription. A second level of control of expR and expI occurs through the PecS repressor, a regulator of pectinase synthesis. PecS represses expI expression, while ExpR activates pecS transcription, suggesting the existence of a mutual control between pecS and the expI–expR system in E. chrysanthemi. Regulation of pectinase synthesis in soft rot Erwinia appears to be a complex network of multiple cross‐acting regulatory elements. A model that integrates these regulatory elements is proposed.

Purification and functional characterization of the KdgR protein, a major repressor of pectinolysis genes of Erwinia chrysanthemi

The phytopathogenicity of the enterobacterium Erwinia chrysanthemi chiefly results from its capacity to degrade pectin, which is the major component of plant cell walls. This degradation requires the product of 12 genes which constitute independent transcriptional units. All these genes, including kdgT which encodes the 2‐keto‐3‐deoxygluconate (KDG) transport system, are negatively regulated by the KdgR protein. The E. chrysanthemi KdgR gene was cloned into an expression vector and overexpressed in Escherichia coli. KdgR was then purified to homogeneity by two chromatographic steps as a dimer of approximately 62kDa. Using gel retardation assays, we demonstrated that this purified repressor binds to the 25 bp oligonucleotide (AAAAAAGAAACATTGTTTCATTTGT) present in the kdgT regulatory region. Dimethyl sulphate interference experiments revealed that the repressor interacts with four guanine bases and 10 adenine bases in the two strands of this KdgR box. KDG, an actual inducer of pectinolysis, releases the repressor from the operator complexes, whereas galacturonate, which is the precursor of the actual inducer, does not. These results suggest the existence of a specific interaction between KDG and KdgR protein. This study opens discussion on the relative affinity of the KdgR protein for the different operators of pectinolysis genes which are interpreted in terms of differential regulation.

PecS Is a Global Regulator of the Symptomatic Phase in the Phytopathogenic Bacterium Erwinia chrysanthemi 3937

Pathogenicity of the enterobacterium Erwinia chrysanthemi (Dickeya dadantii), the causative agent of soft-rot disease in many plants, is a complex process involving several factors whose production is subject to temporal regulation during infection. PecS is a transcriptional regulator that controls production of various virulence factors. Here, we used microarray analysis to define the PecS regulon and demonstrated that PecS notably regulates a wide range of genes that could be linked to pathogenicity and to a group of genes concerned with evading host defenses. Among the targets are the genes encoding plant cell wall-degrading enzymes and secretion systems and the genes involved in flagellar biosynthesis, biosurfactant production, and the oxidative stress response, as well as genes encoding toxin-like factors such as NipE and hemolysin-coregulated proteins. In vitro experiments demonstrated that PecS interacts with the regulatory regions of five new targets: an oxidative stress response gene (ahpC), a biosurfactant synthesis gene (rhlA), and genes encoding exported proteins related to other plant-associated bacterial proteins (nipE, virK, and avrL). The pecS mutant provokes symptoms more rapidly and with more efficiency than the wild-type strain, indicating that PecS plays a critical role in the switch from the asymptomatic phase to the symptomatic phase. Based on this, we propose that the temporal regulation of the different groups of genes required for the asymptomatic phase and the symptomatic phase is, in part, the result of a gradual modulation of PecS activity triggered during infection in response to changes in environmental conditions emerging from the interaction between both partners.

Genome Sequence of the Plant-Pathogenic Bacterium Dickeya dadantii 3937

Dickeya dadantii is a plant-pathogenic enterobacterium responsible for the soft rot disease of many plants of economic importance. We present here the sequence of strain 3937, a strain widely used as a model system for research on the molecular biology and pathogenicity of this group of bacteria.

Purification and functional characterization of PecS, a regulator of virulence‐factor synthesis in Erwinia chrysanthemi

The Erwinia chrysanthemi pecS gene encodes a repressor that negatively regulates the expression of virulence factors such as pectinases or cellulases. The cloned pecS gene was overexpressed using a phage T7 system. The purification of PecS involved DEAE‐anion exchange and TSK‐heparin columns and delivered the PecS protein that was purified to homogeneity. The purified repressor displayed an 18 kDa apparent molecular mass and an isoelectric point near to neutrality (PI = 6.5). Gel‐filtration experiments revealed that the PecS protein is a dimer. Bandshift assays demonstrated that the PecS protein could specifically bind in vitro to the regulatory sites of the in vivo PecS‐regulated genes. The interaction between the PecS protein and its DNA‐binding site was characterized by a relatively low affinity (about 10−8 M). DNase I footprintings revealed short protected sequences only with the most in vivo PecS‐regulated genes. Alignment of these PecS‐binding sites did not show a well‐conserved consensus sequence. lmmunoblotting demonstrated that the copy number of the PecS protein was approximately 50 dimers per cell. The low affinity of the PecS repressor for its DNA targets and the low cellular PecS content suggest the existence of E. chrysanthemi‐specific factors able to potentiate PecS protein activity in vivo.