Sylvie Rouquier

Distribution of olfactory receptor genes in the human genome

We demonstrate that members of the olfactory receptor (OR) gene family are distributed on all but a few human chromosomes. Through FISH analysis, we show that OR sequences reside at more than 25 locations in the human genome. Their distribution is biased for terminal bands. Flow-sorted chromosomes were used to isolate 87 OR sequences derived from 16 chromosomes. Their sequence-relationships are indicative of the inter- and intrachromosomal duplications responsible for OR family expansion. The human genome has accumulated a striking number of dysfunctional copies: 72% of the sequences are pseudogenes. ORF-containing sequences predominate on chromosomes 7,16 and 17.

Evolutionary study of multigenic families mapping close to the human MHC class I region.

SummaryDuring a search for novel coding sequences within the human MHC class I region (chromosome 6p21.3), we found an exon (named B30-2) coding for a 166-amino-acid peptide which is very similar to the C-terminal domain of several coding sequences: human 52-kD Sjögrens syndrome nuclear antigen A/Ro (SS-A/Ro) and ret finger protein (RFP), Xenopus nuclear factor 7 (XNF7), and bovine butyrophilin. The first three of these proteins share similarities over the whole length of the molecule whereas butyrophilin is similar in the C-terminal domain. The N-terminal domain of butyrophilin is similar to rat myelin/oligodendrocyte glycoprotein (MOG) and chicken B blood group system (B-G) protein. These domains are components of a new subfamily of the immunoglobulin superfamily (IgSF). Butyrophilin is thus a mosaic protein composed of the MOG/B-G Ig-like domain and the C-terminal domain of 52-kD SS-A/Ro, RFP, and XNF7 (1330-2-like domain). Moreover, in situ hybridization shows that RFP, butyrophilin, and MOG map to the human chromosome 6p2l.3-6p22 region and are thus close to the MHC class I genes. It is therefore possible that the butyrophilin gene is the product of an exon shuffling event which occurred between ancestors of the RFP and MOG genes. To our knowledge, this is the first example of the colocalization of a chimeric gene and its putative progenitors. Finally, regulatory protein T-lymphocyte 1 (Rpt-1) shares similarities with the N-terminal halves of RFP, 52-kD SS-A/Ro, and XNF7, but not with the B30-2-like domain. We show that the ancestral Rpt-l gene evolved by overprinting.

A single olfactory receptor specifically binds a set of odorant molecules

The sense of smell is mediated by the initiation of action potential in olfactory sensory neurons during odor stimulation. However, little is known about odorant‐olfactory receptor (OR) recognition mechanisms. In the present work, we identified the structural motifs of odorant molecules required to activate mouse OR912‐93 by detection of the odorant response using calcium measurement in cells transfected with OR and Gαq and Gα15 proteins. The use of sets of odorants led to the identification of ketones with an aliphatic carbon chain length ≥u2003four carbon atoms and a carbonyl group preferentially located in position C2 or C3. The threshold of detection of these odorants is as low as 10−6−10−8m. No other odorant ligand, out of 70 representatives of the odorant world, was active. The human ortholog of OR912‐93 is not functional, suggesting that apart from a stop‐mutation located at the 5′‐end that was corrected in the construct, it incurred other deleterious mutations during evolution.

Expansion of the BPI family by duplication on human chromosome 20: characterization of the RY gene cluster in 20q11.21 encoding olfactory transporters/antimicrobial-like peptides☆ ☆

Antimicrobial peptides provide a defense system against microorganisms. One class of these molecules binds lipophilic substrates and is therefore directed against gram-negative bacteria. This family includes proteins related to bactericidal/permeability-increasing protein (BPI). We characterized an approximately 100-kb cluster of three human genes named RYSR, RYA3, and RY2G5 that are related to the BPI family. The RY cluster maps to 20q11.21, >5 Mb upstream of the BPI cluster. The RY and BPI genes have similar exon structures, indicating that they were derived by duplication from a common ancestor. We identified mouse BPI-related and RY orthologues in syntenic regions, indicating that the gene family expanded before mouse and human diverged. Expression analyses show that RYs are strongly expressed in the olfactory epithelium, suggesting that they also could act as odorant transporters or detoxification agents in the olfactory system. Together, these data show how mammals diversified their antimicrobial defenses/olfactory pathways through a duplication-driven adaptive selection process.

Plk1 Regulates Both ASAP Localization and Its Role in Spindle Pole Integrity

Bipolar spindle formation is essential for faithful chromosome segregation at mitosis. Because centrosomes define spindle poles, abnormal number and structural organization of centrosomes can lead to loss of spindle bipolarity and genetic integrity. ASAP (aster-associated protein or MAP9) is a centrosome- and spindle-associated protein, the deregulation of which induces severe mitotic defects. Its phosphorylation by Aurora A is required for spindle assembly and mitosis progression. Here, we show that ASAP is localized to the spindle poles by Polo-like kinase 1 (Plk1) (a mitotic kinase that plays an essential role in centrosome regulation and mitotic spindle assembly) through the γ-TuRC-dependent pathway. We also demonstrate that ASAP is a novel substrate of Plk1 phosphorylation and have identified serine 289 as the major phosphorylation site by Plk1 in vivo. ASAP phosphorylated on serine 289 is localized to centrosomes during mitosis, but this phosphorylation is not required for its Plk1-dependent localization at the spindle poles. We show that phosphorylated ASAP on serine 289 contributes to spindle pole stability in a microtubule-dependent manner. These data reveal a novel function of ASAP in centrosome integrity. Our results highlight dual ASAP regulation by Plk1 and further confirm the importance of ASAP for spindle pole organization, bipolar spindle assembly, and mitosis.

Gene organization, evolution and expression of the microtubule-associated protein ASAP (MAP9)

BackgroundASAP is a newly characterized microtubule-associated protein (MAP) essential for proper cell-cycling. We have previously shown that expression deregulation of human ASAP results in profound defects in mitotic spindle formation and mitotic progression leading to aneuploidy, cytokinesis defects and/or cell death. In the present work we analyze the structure and evolution of the ASAP gene, as well as the domain composition of the encoded protein. Mouse and Xenopus cDNAs were cloned, the tissue expression characterized and the overexpression profile analyzed.ResultsBona fide ASAP orthologs are found in vertebrates with more distantly related potential orthologs in invertebrates. This single-copy gene is conserved in mammals where it maps to syntenic chromosomal regions, but is also clearly identified in bird, fish and frog. The human gene is strongly expressed in brain and testis as a 2.6 Kb transcript encoding a ~110 KDa protein. The protein contains MAP, MIT-like and THY domains in the C-terminal part indicative of microtubule interaction, while the N-terminal part is more divergent. ASAP is composed of ~42% alpha helical structures, and two main coiled-coil regions have been identified. Different sequence features may suggest a role in DNA damage response. As with human ASAP, the mouse and Xenopus proteins localize to the microtubule network in interphase and to the mitotic spindle during mitosis. Overexpression of the mouse protein induces mitotic defects similar to those observed in human. In situ hybridization in testis localized ASAP to the germ cells, whereas in culture neurons ASAP localized to the cell body and growing neurites.ConclusionThe conservation of ASAP indicated in our results reflects an essential function in vertebrates. We have cloned the ASAP orthologs in mouse and Xenopus, two valuable models to study the function of ASAP. Tissue expression of ASAP revealed a high expression in brain and testis, two tissues rich in microtubules. ASAP associates to the mitotic spindle and cytoplasmic microtubules, and represents a key factor of mitosis with possible involvement in other cell cycle processes. It may have a role in spermatogenesis and also represents a potential new target for antitumoral drugs. Possible involvement in neuron dynamics also highlights ASAP as a candidate target in neurodegenerative diseases.

Expression of the Microtubule-Associated Protein MAP9/ASAP and Its Partners AURKA and PLK1 in Colorectal and Breast Cancers

Background. Colorectal and breast cancers are among the most common cancers worldwide. They result from a conjugated deficiency of gene maintenance and cell cycle control. Objective. We investigate the expression of the microtubule-associated protein MAP9/ASAP and its two partners AURKA and PLK1 in colorectal tumors as well as in ductal breast cancers. Materials and Methods. 26 colorectal cancer samples and adjacent normal tissues and 77 ductal breast cancer samples from grade I to grade III were collected. Real-time quantitative PCR was used to analyse the expression of MAP9, AURKA, and PLK1. Results. Expression of MAP9 is downregulated in colorectal cancer compared to normal tissues (P > 10−3), whereas those of AURKA and PLK1 are upregulated (P > 10−4). In ductal breast cancer, we found a grade-dependent increase of AURKA expression (P > 10−3), while the variations of expression of MAP9 and PLK1 are not significant (P > 0.2). Conclusions. MAP9 downregulation is associated with colorectal malignancy and could be used as a disease marker and a new drug target, while AURKA and PLK1 are upregulated. In ductal breast cancer, AURKA overexpression is strongly associated with the tumor grade and is therefore of prognostic value for the progression of the disease.

Microtubule-associated protein 9 (Map9/Asap) is required for the early steps of zebrafish development

Microtubules are structural components of the cell cytoskeleton and key factors for mitosis and ciliogenesis in eukaryotes. The regulation of MT dynamics requires non-motor MAPs. We previously showed that, in human cells in culture, MAP9 (also named ASAP) is involved in MT dynamics and is essential for mitotic spindle formation and mitosis progression. Indeed, misexpression of MAP9 leads to severe mitotic defects and cell death. Here, we investigated the in vivo role of map9 during zebrafish development. Map9 is expressed mainly as a maternal gene. Within cells, Map9 is associated with the MT network of the mitotic spindle and with centrosomes. Morpholino-mediated depletion of map9 leads to early development arrest before completion of epiboly. Map9 localizes to the MT array of the YSL. This MT network is destroyed in Map9-depleted embryos, and injection of anti-map9 morpholinos directly in the nascent YSL leads to arrest of epiboly/gastrulation. Finally, map9 knockdown deregulates the expression of genes involved in endodermal differentiation, dorso–ventral and left–right patterning, and other MT-based functions. At low morpholino doses, the surviving embryos show dramatic developmental defects, spindle and mitotic defects, and increased apoptosis. Our findings suggest that map9 is a crucial factor in early zebrafish development by regulating different MT-based processes.

Sequence and chromosomal localization of the mouse ortholog of the human olfactory receptor gene 912-93

Olfactory receptor gene 912-93 (OR912-93) is a member of the OR multigene family encoding heptahelical transmembrane domain G protein-coupled olfactory receptors (Buck and Axel 1991; Rouquier et al. 1998a, 1998b). In primate hominoids, OR912-93 is unique and contains a single nonsense point mutation in human, whereas the gene is potentially coding in the other hominoids except gorilla (Rouquier et al. 1998b). OR912-93 is localized on human Chromosome (Chr) 11q11–12 and in syntenically homologous regions in the other hominoids. The uniqueness of this gene makes it an excellent tool to use in following the evolution of individual OR genes, a task that is very often rendered difficult by cross-hybridization owing to multiple duplication events (BrandArpon et al. 1999; Rouquier et al. 1998a; Trask et al. 1998a,b). In this report, we present the sequence of the OR912-93 mouse ortholog, its chromosomal localization, and the evolution of the protein receptor from rodents to hominoids. We first constructed a minilibrary enriched for mouse ORrelated sequences. OR consensus degenerate primer OR5B and OR3B (Ben-Arie et al. 1994; Rouquier et al. 1998a) were used to amplify by PCR, between transmembrane (TM) domains TM2 and TM7, a complex set of OR-related sequences, with mouse ( Mus musculus domesticus ) genomic DNA as template. The expected 700-bp PCR product was purified and subcloned into the pCR II vector (In Vitrogen, Groningen, NL). Recombinant clones were gridded in microtiter dishes (1536 clones), and high-density filters were generated using a Biomek 2000 robot (Beckman, Fullerton, CA). Filters were then hybridized in duplicate at high stringency with the radiolabeled human 912-93 probe. Six clones were isolated, and sequencing showed that they are identical. The sequence contains an uninterrupted open reading frame (ORF) and is therefore, part of a potentially coding OR gene. Sequence comparison of the predicted mouse protein with the corresponding sequence in the human 912-93 clone showed 65% nucleotide sequence identity (NSI) and 63% amino acid sequence identity (ASI) (not shown). These results suggested that the PCR-generated sequence probably corresponds to the mouse ortholog of the human 912-93 gene. To isolate the full-length gene, we screened a genomic DNA library generated from NIH3T3 mouse DNA and packaged in the Lambda FIX II vector (generous gift of G. Lutfalla). Specific primers (93MF1—58 CCTGCTCCTCTTCTGTCATAAG 38; 93MR1—58 CTCTCATCATGTCCCAGCGAG 38) were derived from the partial mouse 912-93 sequence and were used to screen the mouse lambda library by PCR at high stringency according to the protocol from Israel (1993). From the final PCR round, two individual positive phages were isolated. Partial sequencing confirmed that the two clones were identical to the initial mouse 912-93 partial clone. Only one, phage 912-93MB5, was characterized further. The PCR screening was confirmed by Southern blot analysis of restriction enzyme-digested phage DNA (not shown). We subcloned a 2.2-kbBglII-fragment containing the mouse 912-93 sequence from phage 912-93MB5 into the Litmus 28 vector (New England Biolabs, Beverly, MA) and sequenced the 912-93 gene with vector and specific primers (primer walking). Sequencing was performed with the Dye Terminator Cycle Sequencing Ready Reaction kit (Perkin Elmer, Foster City, CA) on an Applied Biosystems (ABI) 373 automated sequencer. The complete sequence has been deposited under accession number AF146372. It contains a ∼650-bp 58UTR and a∼600-bp 38UTR. The coding region encodes a 318-amino acid protein that shares between 66% and 68.5% ASI with the OR912-93 sequences from the different hominoids. Figure 1A represents the sequence comparison of mouse and hominoid 912-93-proteins. As expected, the human and mouse proteins are the most distantly related (66.35% ASI). However, the conserved domains exhibit a very high degree of sequence identity (Fig. 1A and Table 1), ranging from 73.7% [IC2, thought to be involved in G protein binding (van Rhee et al. 1995)] to 85.7%, 91.7%, and 85.0% ASI for TM2, TM6, and TM7 respectively, whereas the other domains are between 54% and 67% identical in the two species, with the exception of the Nand C-terminal moieties, which are only 42–44% identical. Particularly, the Cterminal part is composed of a stretch of eight amino acids (RNKEVKDA) next to TM7, which is identical in all the species. In all cases the proteins are terminated by a completely divergent tail of 19 residues (21% ASI), which in the case of mouse is five amino acids longer than the primate proteins. The reason for this difference is unknown but could be correlated to modifications in receptor folding and cell surface expression (Oksche et al. 1998). In Figure 1A are shown the residues that are conserved between mouse and non-human primates. For example, residue 11 is a Glu in all the species but human, and Thr 34 (TM1) is present only in human and chimpanzee, suggesting that this residue (codon) has been inserted during evolution before the divergence of these two species. To appreciate the genetic divergence between mouse and hominoid sequences, a phylogenetic tree is represented in Fig. 1B. Human 912-93, which we have fully characterized (accession number AF045576; Rouquier et al. 1998b), was described at the same time by Buettner and associates (1998) as a member of a group of Chr 11-specific OR genes (OR11-104, accession number AF065871). In this study, the authors showed that OR genes are distributed in at least seven chromosomal sites. The 11q11 site also contains genes OLF1, OR11-7a, OR11-8b, OR11-c, OR11-10, and OR11-12, none of which is closely related (ASI < 52%) to 912-93. OR genes are organized in clusters distributed throughout the genome and originated via multiple duplication events. It has been Sequence data from this article have been deposited with the DDBJ/ EMBL/GenBank Data Libraries under Accession No. AF146372.

Induction of ASAP (MAP9) contributes to p53 stabilization in response to DNA damage

p53 is a key tumor suppressor that controls DNA damage response and genomic integrity. In response to genotoxic stress, p53 is stabilized and activated, resulting in controlled activation of genes involved in cell cycle arrest, DNA repair and/or apoptosis. ASAP is a centrosome- and spindle-associated protein, the deregulation of which induces severe mitotic defects. We show here that following double-strand break DNA formation, ASAP directly interacts with and stabilizes p53 by enhancing its p300-mediated acetylation and blocking its MDM2-mediated ubiquitination and degradation, leading to an increase of p53 transcriptional activity. Upon DNA damage, ASAP is transiently accumulated before being degraded upon persistent damage. This work links the p53 response with the cytoskeleton and confirms that the DNA-damaging signaling pathway is coordinated by centrosomal proteins. We reveal the existence of a new pathway through which ASAP signals the DNA damage response by regulating the p300-MDM2-p53 loop. These results point out ASAP as a possible target for the design of drugs to sensitize radio-resistant tumors.