Thaweesak Chieochansin

A highly prevalent and genetically diversified Picornaviridae genus in South Asian children

Viral metagenomics focused on particle-protected nucleic acids was used on the stools of South Asian children with nonpolio acute flaccid paralysis (AFP). We identified sequences distantly related to Seneca Valley virus and cardioviruses that were then used as genetic footholds to characterize multiple viral species within a previously unreported genus of the Picornaviridae family. The picornaviruses were detected in the stools of >40% of AFP and healthy Pakistani children. A genetically diverse and highly prevalent enteric viral infection, characteristics similar to the Enterovirus genus, was therefore identified substantially expanding the genetic diversity of the RNA viral flora commonly found in children.

Specific Association of Human Parechovirus Type 3 with Sepsis and Fever in Young Infants, as Identified by Direct Typing of Cerebrospinal Fluid Samples

BACKGROUND Human parechoviruses (HPeVs), along with human enteroviruses (HEVs), are associated with neonatal sepsis and meningitis. We determined the relative importance of these viruses and the specific HPeV types involved in the development of central nervous system-associated disease. METHODS A total of 1575 cerebrospinal fluid (CSF) samples obtained during 2006-2008 were screened for HPeV by means of nested polymerase chain reaction. All samples for which results were positive were typed by sequencing of viral protein (VP) 3/VP1. Screening for HEV was performed in parallel, as was detection of HPeV in respiratory and fecal surveillance samples, to identify virus types circulating in the general population. RESULTS HPeV was detected in 14 CSF samples obtained exclusively from young infants (age, <3 months) with sepsis or pyrexia. The frequency of detection of HPeVs varied greatly by year, with the highest frequency (7.2%) noted in 2008 exceeding that of HEVs. Direct typing of CSF samples revealed that all infections were caused by HPeV type 3, a finding that is in contrast to the predominant circulation of HPeV1 in contemporary respiratory and fecal surveillance samples. CONCLUSION HPeV was a significant cause of severe sepsis and fever with central nervous system involvement in young infants, rivaling enteroviruses. The specific targeting of young infants by HPeV type 3 may reflect a difference in tissue tropism between virus types or a lack of protection of young infants by maternal antibody consequent to the recent emergence of HPeV.

Typing (A/B) and subtyping (H1/H3/H5) of influenza A viruses by multiplex real-time RT-PCR assays.

In this study, a specific and sensitive one-step multiplex real-time RT-PCR was developed in two assays by using primers and a number of specific locked nucleic acid (LNA)-mediated TaqMan probes which increase the thermal stability of oligonucleotides. The first assay consisted of primers and probes specific to the matrix (M1) gene of influenza A virus, matrix (M1) gene of influenza B virus and GAPDH gene of host cells for typing of influenza virus and verification by an internal control, respectively. The other assay employed primers and probes specific to the hemagglutinin gene of H1, H3 and H5 subtypes in order to identify the three most prominent subtypes of influenza A capable of infecting humans. The specificity results did not produce any cross reactivity with other respiratory viruses or other subtypes of influenza A viruses (H2, H4 and H6-H15), indicating the high specificity of the primers and probes used. The sensitivity of the assays which depend on the type or subtype being detected was approximately 10 to 10(3)copies/microl that depended on the types or subtypes being detected. Furthermore, the assays demonstrated 100% concordance with 35 specimens infected with influenza A viruses and 34 specimens infected with other respiratory viruses, which were identified by direct nucleotide sequencing. In conclusion, the multiplex real-time RT-PCR assays have proven advantageous in terms of rapidity, specificity and sensitivity for human specimens and thus present a feasible and attractive method for large-scale detection aimed at controlling influenza outbreaks.

Hand, Foot, and Mouth Disease Caused by Coxsackievirus A6, Thailand, 2012

Coxsackievirus A6, Thailand

H5N1 influenza A virus and infected human plasma.

To the Editor: Since January 2004, a total of 22 persons have been confirmed infected with avian influenza A virus (H5N1) in Thailand; 14 of these patients died. Three waves of outbreaks occurred during the past 2 years. The last patient of the third wave was a 5-year-old boy whose symptoms developed on November 28, 2005; he was hospitalized on December 5 and died 2 days later. The child resided in the Ongkharak District, Nakhon Nayok Province, ≈70 km northeast of Bangkok. Villagers informed the Department of Livestock after the patients illness was diagnosed. Five dead chickens had been reported in this area from November 28 to December 1, 2005. Samples from these chickens could not be obtained, thus, no H5N1 testing was performed. The boy had fever, headache, and productive cough for 7 days before he was admitted to the Her Royal Highness Princess Maha Chakri Sirindhorn Medical Center. Clinical examination and chest radiograph showed evidence of lobar pneumonia. He was treated with antimicrobial drugs (midecamycin and penicillin G) and supportive care, including oxygen therapy. On December 7, the patients condition worsened, and severe pneumonia with adult respiratory distress syndrome developed. Laboratory tests showed leukopenia (2,300 cells/mm3), acidosis, and low blood oxygen saturation by cutaneous pulse oximetry (81.6%). Oseltamivir was administered after his parents informed hospital staff about the boys contact with the dead chicken. However, the boy died the same day; no autopsy was performed. On December 9, the cause of death was declared by the Ministry of Public Health to be H5N1 influenza virus. A blood sample was collected from the patient on December 7; anticoagulation was accomplished with ethylenediaminetetraacetic acid (EDTA) for repeated biochemistry analysis and complete blood count. The plasma from the EDTA blood sample was separated 2 days later and stored at –20°C for 12 days. The sample was subsequently given to the Center of Excellence in Viral Hepatitis, Faculty of Medicine, Chulalongkorn University, for molecular diagnosis and then stored at –70°C, where specific precautions implemented for handling highly infectious disease specimens such as H5N1 influenza virus were observed. Plasma was examined by multiplex reverse transcription–polymerase chain reaction (RT-PCR) (1) and multiplex real-time RT-PCR (2), both of which showed positive results for H5N1 virus. The virus titer obtained from the plasma was 3.08 × 103 copies/mL. The plasma specimen was processed for virus isolation by embryonated egg injection, according to the standard protocol described by Harmon (3). Briefly, 100 μL 1:2 diluted plasma was injected into the allantoic cavity of a 9-day-old embryonated egg and incubated at 37°C. The infected embryo died within 48 hours, and the allantoic fluid was shown to contain 2,048 hemagglutinin (HA) units; also, subtype H5N1 was confirmed (1,2). Whole genome sequencing was performed and submitted to the GenBank database under the strain A/Thailand/NK165/05 accession no. DQ 372591-8. The phylogenetic trees of the HA and neuraminidase (NA) genes were constructed by using MEGA 3 (4) for comparison with H5N1 viruses isolated from humans, tigers, and chickens from previous outbreaks in 2004 and 2005 (Figure). The sequence analyses of the viruses showed that the HA cleavage site contained SPQREKRRKKR, which differed from the 2004 H5N1 virus by an arginine-to-lysine substitution at position 341. That finding had also been observed in wild bird species during earlier outbreaks in Thailand in 2004 (5). Similar to the 2004–2005 H5N1 isolates from Thailand, a 20–amino acid deletion at the NA stalk region was observed. Moreover, the amino acid residues (E119, H274, R292, and N294) of the NA active site were conserved, which suggests that the virus was sensitive to oseltamivir. In addition, a single amino acid substitution from glutamic acid to lysine at position 627 of PB2 showed increased virus replication efficiency in mammals (6). Figure Phylogenetic analysis of the hemagglutinin and neuraminidase genes of H5N1 from study patient compared with sequences from previous outbreaks (2004–2005). Observing live influenza virus in human serum or plasma is unusual. However, in 1963, low quantities of virus were isolated from blood of a patient on day 4 of illness (7), and in 1970, the virus was cultivated from blood specimens from 2 patients (8). Recently, a fatal case of avian influenza A (H5N1) in a Vietnamese child was reported. The diagnosis was determined by isolating the virus from cerebrospinal fluid, fecal, throat, and serum specimens (9); viral RNA was found in 6 of 7 serum specimens 4–9 days after the onset of illness (10). In this case, the H5N1 virus could be isolated from plasma on day 10 after symptoms developed. This case showed the virus in the patients blood, which raises concern about transmission among humans. Because probable H5N1 avian influenza transmission among humans has been reported (11), this case should be a reminder of the necessity to carefully handle and transport serum or plasma samples suspected to be infected with H5N1 avian influenza. Because viable virus has been detected in blood samples, handling, transportation, and testing of blood samples should be performed in a biosafety (category III) containment laboratory to prevent the spread of the virus to healthcare and laboratory workers. We express our thanks to the Thailand Research Fund (Senior Research Scholar), Royal Golden Jubilee PhD Program and Center of Excellence in Viral Hepatitis Research, and Prasert Auewarakul for their generous support of our study.

Recombination dynamics of human parechoviruses: investigation of type-specific differences in frequency and epidemiological correlates.

Human parechoviruses (HPeVs) are highly prevalent RNA viruses classified in the family Picornaviridae. Several antigenically distinct types circulate in human populations worldwide, whilst recombination additionally contributes to the genetic heterogeneity of the virus. To investigate factors influencing the likelihood of recombination and to compare its dynamics among types, 154 variants collected from four widely geographically separated referral centres (UK, The Netherlands, Thailand and Brazil) were typed by VP3/VP1 amplification/sequencing with recombination groups assigned by analysis of 3Dpol sequences. HPeV1B and HPeV3 were the most frequently detected types in each referral region, but with marked geographical differences in the frequencies of different recombinant forms (RFs) of types 1B, 5 and 6. HPeV1B showed more frequent recombination than HPeV3, in terms both of evolutionary divergence and of temporal/geographical indicators of population separation. HPeV1 variants showing between 10 and 20% divergence in VP3/VP1 almost invariably fell into different recombination groups, compared with only one-third of similarly divergent HPeV3 variants. Substitution rates calculated by beast in the VP3/VP1 region of HPeV1 and HPeV3 allowed half-lives of the RFs of 4 and 20 years, respectively, to be calculated, estimates fitting closely with their observed lifespans based on population sampling. The variability in recombination dynamics between HPeV1B and HPeV3 offers an intriguing link with their markedly different seasonal patterns of transmission, age distributions of infection and clinical outcomes. Future investigation of the epidemiological and biological opportunities and constraints on intertypic recombination will provide more information about its influence on the longer term evolution and pathogenicity of parechoviruses.

Prevalence and characterization of enterovirus infections among pediatric patients with hand foot mouth disease, herpangina and influenza like illness in Thailand, 2012.

Hand, foot, and mouth disease (HFMD) and herpangina are common infectious diseases caused by several genotypes of human enterovirus species A and frequently occurring in young children. This study was aimed at analyzing enteroviruses from patients with these diseases in Thailand in 2012. Detection and genotype determination of enteroviruses were accomplished by reverse transcription-polymerase chain reaction and sequencing of the VP1 region. Enterovirus-positive samples were differentiated into 17 genotypes (coxsackievirus A4 (CAV4), A5, A6, A8, A9, A10, A12, A16, A21, B1, B2, B4, B5, echovirus 7, 16, 25 and Enterovirus 71). The result showed CAV6 (33.5%), followed by CAV16 (9.4%) and EV71 (8.8%) as the most frequent genotypes in HFMD, CAV8 (19.3%) in herpangina and CAV6 (1.5%) in influenza like illness. Enterovirus infections were most prevalent during July with 34.4% in HFMD, 39.8% in herpangina and 1.6% in ILI. The higher enterovirus infection associated with HFMD and herpangina occurred in infants over one year-old. This represents the first report describing the circulation of multiple enteroviruses in Thailand.

Human bocavirus (HBoV) in Thailand: Clinical manifestations in a hospitalized pediatric patient and molecular virus characterization

Summary Objective Human bocavirus (HBoV), a novel virus, which based on molecular analysis has been associated with respiratory tract diseases in infants and children have recently been studied worldwide. To determine prevalence, clinical features and perform phylogenetic analysis in HBoV infected Thai pediatric patients. Methods HBoV was detected from 302 nasopharyngeal (NP) suctions of pediatric patients with acute lower respiratory tract illness and sequenced applying molecular techniques. Results The incidence of HBoV infection in pediatric patients amounted to 6.62% with 40% co-infected with other respiratory viruses. There were no clinical specific manifestations for HBoV; however, fever and productive cough were commonly found. Generalized rales and wheezing were detected in most of the patients as well as perihilar infiltrates. The alignment and phylogenetic analysis of partial VP1 genes showed minor variations. Conclusion Our results indicated that HBoV can be detected in nasopharyngeal aspirate specimens from infants and children with acute lower respiratory tract illness.

Parvovirus 4 (PARV4) in Serum of Intravenous Drug Users and Blood Donors

PARV4 is a novel parvovirus found in serum and is transmitted by blood contact. A previous study reported that intravenous drug users (IVDUs) are at high-risk for PARV4 infection [1]. In this study, the sera obtained from IVDUs in Thailand were screened for several viruses including parvovirus 4 (PARV4), human bocavirus (HBoV), parvovirus B19, hepatitis C virus (HCV), human immunodeficiency virus (HIV), and hepatitis B virus (HBV). Novel parvoviruses in humans, termed PARV4 and human bocavirus (HBoV), were identified using molecular techniques [2, 3]. The prevalence of PARV4 among IVDUs was also compared with blood donors. PARV4 is a DNA virus belonging to the Parvoviridae family, such as parvovirus B19, which can infect humans. PARV4 has been classified into two genotypes, with the second one previously termed human parvovirus 5 (PARV5) [4]. Its nucleotide sequence is 92% similar to that of PARV4 [5]. PARV4 has been found in the plasma of a patient with symptoms of acute virus infection syndrome associated with a lifestyle putting him at high risk for HIV-1 infection; yet, the patient was HIV-1 negative [3]. Moreover, IVDUs are at high risk for PARV4 infection which is blood borne, and a previous study has also detected these viruses in plasma [5]. The second parvovirus, human bocavirus (HBoV) can be identified in respiratory samples of children with lower respiratory tract infections [6]. PARV4 infection has not been reported anywhere in Asia. Therefore, the objective of this study has been to screen sera obtained from intravenous drug users in Thailand for PARV4, HBoV, parvovirus B19, HCV, HIV, and HBV. PARV4, HBoV, and parvovirus B19 were screened by polymerase chain reaction (PCR). HCV and HBV were tested using both serological detection and reverse transcriptase (RT) PCR and PCR, respectively. HIV was screened by using serological testing. Consent for use of stored sera and the specimens of blood donors was obtained from the Ethics committee, Faculty of Medicine, Chulalongkorn University and the director of the National Blood Center, Thai Red Cross, Bangkok. Serum samples were collected from 88 intravenous drug users in Thailand during the year 2000 and stored at –70 C. There were 83 male and 5 female patients. None of them had been treated with antiviral drugs. In addition, blood donor sera were randomly retrieved from the National Blood Center to be used as control. These were collected from 80 males and 96 females who tested negative for HBV, HCV, and HIV. PARV4 detection was performed as follows: the primers designed to match the conserved regions of the open reading frame1 (ORF1), PV4ORF1F (5¢-AAGACTACATACCTACCTGTG-3¢) and PV4ORF1R (5’GTGCCTTTCATATTCAGTTCC3’), amplified a 220-bp region as previously described by Fryer et al. [5]. The PCR reaction mixture comprised 2 ll of DNA, 0.5 lmol l sense primer PV4ORF1F, 0.5 lmol l antisense primer PV4ORF1R, 10 ll of 2.5· MasterMix (Eppendorf, Hamburg, Germany) and nuclease-free water to a final volume of 25 ll. Each individual sample was pre-incubated at 94 C for 3 min to activate the HotStartTaq DNA polymerase. This was followed by 40 cycles of amplification including denaturation (94 C for 30 s), annealing (50 C for 30 s) and extension (72 C for 30 s). Subsequently, semi-nested amplification was performed using primer PV4ORF1F2 (nt 1557–1579) 5’GTTACAGTTGATGGCCCTGTGG-3’) amplified a 159-bp under the same conditions as described earlier except for the annealing temperature which was raised to 58 C for 30 s. To prepare the sensitivity test, plasmid concentration was determined by measuring OD260 followed by tenfold serial dilutions from 10 to 1 copies ll, which were subsequently used as templates for PCR sensitivity tests. The specificity of PV4ORF1F and PV4ORF1R has been described by Fryer et al. [5]. The specificity of PV4ORF1F2 was also tested with parvovirus B19 and PCR products were confirmed by directed sequencing. Human bocavirus was detected as described by Chieochansin et al. [7]. Parvovirus B19 was discovered in serum samples by conventional nested-PCR as reported elsewhere [8]. Samples were serologically tested for HIV, HBV, and HCV using Murex (Abbott Laboratory, Wiesbaden, Germany) for the HIV Ag/Ab combination, HBsAg (AUSAB EIA) and antiHCV (ABBOTT HCV EIA 3.0), according to the manufacturer’s specifications. HCV and HBV were also screened for their respective

Prevalence and molecular characterization of WU/KI polyomaviruses isolated from pediatric patients with respiratory disease in Thailand

Abstract WU and KI polyomaviruses represent novel viruses discovered in respiratory secretions from human patients with acute respiratory tract infection. However, the association between WU/KI polyomaviruses and human disease has remained unclear. In this study, the prevalence of these two novel viruses and occurrence of co-infection with other respiratory viruses were determined in Thai pediatric patients with respiratory disease. Previously described PCR assays were applied to detect WU/KI polyomaviruses as well as other respiratory viruses in 302 nasopharyngeal suction specimens collected from February 2006 through February 2007. The results revealed the anneal prevalence of WU and KI polyomaviruses in the Thai population was 6.29% and 1.99%, respectively. The frequency of co-detection of WU and KI polyomaviruses with other respiratory viral pathogens was 42.11% and 33.33%, respectively. Moreover, each of the two complete genome sequences of WU (CU_295 and CU_302) and KI (CU_255 and CU_258) polyomaviruses were genetically and phylogenetically characterized. Sequence analysis showed that they contained features common to those found in previous studies. However, there were several nucleotide variations within the non-coding regulatory regions and various non-synonymous mutations within the coding regions which may influence virulence and pathogenesis of these viruses. Nevertheless, it is still possible that these viruses are not the causative agents of clinical respiratory disease. Therefore, judging the association of WU/KI polyomavirus infections with a particular disease will be challenging and require more comprehensive case control investigations.