Thomas G. Martin

Lenalidomide after stem-cell transplantation for multiple myeloma

BACKGROUND Data are lacking on whether lenalidomide maintenance therapy prolongs the time to disease progression after autologous hematopoietic stem-cell transplantation in patients with multiple myeloma. METHODS Between April 2005 and July 2009, we randomly assigned 460 patients who were younger than 71 years of age and had stable disease or a marginal, partial, or complete response 100 days after undergoing stem-cell transplantation to lenalidomide or placebo, which was administered until disease progression. The starting dose of lenalidomide was 10 mg per day (range, 5 to 15). RESULTS The study-drug assignments were unblinded in 2009, when a planned interim analysis showed a significantly longer time to disease progression in the lenalidomide group. At unblinding, 20% of patients who received lenalidomide and 44% of patients who received placebo had progressive disease or had died (P<0.001); of the remaining 128 patients who received placebo and who did not have progressive disease, 86 crossed over to lenalidomide. At a median follow-up of 34 months, 86 of 231 patients who received lenalidomide (37%) and 132 of 229 patients who received placebo (58%) had disease progression or had died. The median time to progression was 46 months in the lenalidomide group and 27 months in the placebo group (P<0.001). A total of 35 patients who received lenalidomide (15%) and 53 patients who received placebo (23%) died (P=0.03). More grade 3 or 4 hematologic adverse events and grade 3 nonhematologic adverse events occurred in patients who received lenalidomide (P<0.001 for both comparisons). Second primary cancers occurred in 18 patients who received lenalidomide (8%) and 6 patients who received placebo (3%). CONCLUSIONS Lenalidomide maintenance therapy, initiated at day 100 after hematopoietic stem-cell transplantation, was associated with more toxicity and second cancers but a significantly longer time to disease progression and significantly improved overall survival among patients with myeloma. (Funded by the National Cancer Institute; ClinicalTrials.gov number, NCT00114101.).

A phase 2 study of single-agent carfilzomib (PX-171-003-A1) in patients with relapsed and refractory multiple myeloma

Carfilzomib is a next-generation, selective proteasome inhibitor being evaluated for the treatment of relapsed and refractory multiple myeloma. In this open-label, single-arm phase 2 study (PX-171-003-A1), patients received single-agent carfilzomib 20 mg/m(2) intravenously twice weekly for 3 of 4 weeks in cycle 1, then 27 mg/m(2) for ≤ 12 cycles. The primary endpoint was overall response rate (≥ partial response). Secondary endpoints included clinical benefit response rate (≥ minimal response), duration of response, progression-free survival, overall survival, and safety. A total of 266 patients were evaluable for safety, 257 for efficacy; 95% were refractory to their last therapy; 80% were refractory or intolerant to both bortezomib and lenalidomide. Patients had median of 5 prior lines of therapy, including bortezomib, lenalidomide, and thalidomide. Overall response rate was 23.7% with median duration of response of 7.8 months. Median overall survival was 15.6 months. Adverse events (AEs) were manageable without cumulative toxicities. Common AEs were fatigue (49%), anemia (46%), nausea (45%), and thrombocytopenia (39%). Thirty-three patients (12.4%) experienced peripheral neuropathy, primarily grades 1 or 2. Thirty-three patients (12.4%) withdrew because of an AE. Durable responses and an acceptable tolerability profile in this heavily pretreated population demonstrate the potential of carfilzomib to offer meaningful clinical benefit. This trial was registered at www.clinicaltrials.gov as #NCT00511238.

Widespread Genetic Heterogeneity in Multiple Myeloma: Implications for Targeted Therapy

We performed massively parallel sequencing of paired tumor/normal samples from 203 multiple myeloma (MM) patients and identified significantly mutated genes and copy number alterations and discovered putative tumor suppressor genes by determining homozygous deletions and loss of heterozygosity. We observed frequent mutations in KRAS (particularly in previously treated patients), NRAS, BRAF, FAM46C, TP53, and DIS3 (particularly in nonhyperdiploid MM). Mutations were often present in subclonal populations, and multiple mutations within the same pathway (e.g., KRAS, NRAS, and BRAF) were observed in the same patient. In vitro modeling predicts only partial treatment efficacy of targeting subclonal mutations, and even growth promotion of nonmutated subclones in some cases. These results emphasize the importance of heterogeneity analysis for treatment decisions.

Integrated safety profile of single-agent carfilzomib: experience from 526 patients enrolled in 4 phase II clinical studies

Carfilzomib, a selective proteasome inhibitor, was approved in 2012 for the treatment of relapsed and refractory multiple myeloma. Safety data for single-agent carfilzomib have been analyzed for 526 patients with advanced multiple myeloma who took part in one of 4 phase II studies (PX-171-003-A0, PX-171-003-A1, PX-171-004, and PX-171-005). Overall analyses of adverse events and treatment modifications are presented, as well as specific analyses of adverse events by organ system. Overall, the most common adverse events of any grade included fatigue (55.5%), anemia (46.8%), and nausea (44.9%). In the grouped analyses, any grade adverse events were reported in 22.1% for any cardiac (7.2% cardiac failure), 69.0% for any respiratory (42.2% dyspnea), and 33.1% for any grouped renal impairment adverse event (24.1% increased serum creatinine). The most common non-hematologic adverse events were generally Grade 1 or 2 in severity, while Grade 3/4 adverse events were primarily hematologic and mostly reversible. There was no evidence of cumulative bone marrow suppression, either neutropenia or thrombocytopenia, and febrile neutropenia occurred infrequently (1.1%). Notably, the incidence of peripheral neuropathy was low overall (13.9%), including patients with baseline peripheral neuropathy (12.7%). Additionally, the incidence of discontinuations or dose reductions attributable to adverse events was low. These data demonstrate that single-agent carfilzomib has an acceptable safety profile in heavily pre-treated patients with relapsed/refractory multiple myeloma. The tolerable safety profile allows for administration of full-dose carfilzomib, both for extended periods and in a wide spectrum of patients with advanced multiple myeloma, including those with pre-existing comorbidities.

Thrombopoietin Levels in Patients with Cirrhosis before and after Orthotopic Liver Transplantation

Thrombocytopenia in patients with cirrhosis has historically been attributed to hypersplenism. Radiolabeled platelet studies have clearly demonstrated splenic sequestration in cirrhosis and have shown that up to 90% of platelets can localize to the spleen [1-3]. However, portal decompression procedures have failed to consistently improve thrombocytopenia [4-7] and thrombocytopenia can persist after splenectomy [8]. Therefore, other factors must be involved. Thrombopoietin is a potent stimulator of megakaryocyte growth and platelet production [9]. Synthesis of thrombopoietin probably occurs in the liver [10]. In this study, we measured plasma thrombopoietin levels in cirrhotic patients who had thrombocytopenia and evaluated changes in these levels throughout orthotopic liver transplantation. Levels of messenger RNA (mRNA) in thrombopoietin in liver samples taken from patients with cirrhosis and controls were compared. Our hypothesis was that production of thrombopoietin is altered in patients with cirrhosis and that impaired transcription of thrombopoietin mRNA may contribute to this alteration. Methods Two separate convenience samples taken from patients with cirrhosis (17 patients who had and 27 patients who did not have orthotopic liver transplantation) were recruited from the gastroenterology services at the University of California, San Francisco, Medical Center. All 44 patients had persistent or stable thrombocytopenia for more than 2 weeks (platelet count < 120 000 cells/microL). Patients with acute intercurrent illnesses were excluded. Patients were selected for transplantation on the basis of standard criteria (severity of disease and organ availability). These patients received an ABO-matched cadaver liver and standard post-transplantation immunosuppressive drugs, including corticosteroids, azathioprine, and cyclosporine. Approval was obtained from the Committee on Human Research at the University of California, San Francisco: all patients provided informed consent. The enrollment period was from June 1995 through April 1996. The 27 patients with cirrhosis who did not have transplantation provided one random plasma sample. The 17 patients who had orthotopic liver transplantations had plasma samples taken before transplantation; within 4 to 12 hours after transplantation; and every Monday, Wednesday, and Friday thereafter until discharge or until the platelet count was normal. This schedule was adopted from previous studies of patients who had bone marrow transplantation [11]. Platelet counts were obtained daily for all 17 patients until discharge, as per standard protocol for orthotopic liver transplantation. The samples were frozen at 80C before being measured. Two enzyme-linked immunosorbent assays (ELISAs) were used during the study. The initial assay used a chimeric molecule that consisted of c-mpl extracellular domain fused to the Fc portion of human immunoglobulin for capture and a rabbit polyclonal antibody to thrombopoietin for detection. The second was a murine antithrombopoietin monoclonal antibody sandwich-type assay. The detection limits of the assays were 160 and 40 pg/mL, respectively. The second ELISA was available for the final 13 patients with cirrhosis and 10 patients who had liver transplantation. Cirrhotic liver samples were obtained from explanted livers during surgery (n = 9). Samples of livers from controls were obtained during partial hepatectomy for localized metastases of colon cancer (n = 5) or primary liver cancer (n = 2; 1 patient had leiomyosarcoma, and 1 had hepatoma) and during orthotopic liver transplantation for hereditary hyperoxaluria (n = 1). Liver tissue was obtained from areas of normal-appearing parenchyma. All patients had normal platelet counts, prothrombin times, and aminotransferase levels. Samples were snap-frozen in liquid nitrogen and stored at 80C. Total RNA was isolated from cryopreserved liver tissue by using the ULTRASPEC RNA Isolation System (Biotecx Lab, Houston, Texas) according to the manufacturers instructions. Reverse-transcription polymerase chain reaction (PCR) was done using 100 ng of total RNA, a thrombopoietin-specific reverse primer, and the Promega Access RT-PCR system (Promega, Madison, Wisconsin). The Perkin Elmer 7700 Sequence Detector System (Perkin Elmer, Foster City, Caliornia) was used for DNA amplification as described elsewhere [12]. The thrombopoietin-specific forward primer was 5GCCAAGATTCCTGGTCTGCTGAAC3, and the reverse primer was 5GCTGATGTCGGCAGTGTCTGAGAA3. A fluorogenic probe specific for thrombopoietin (5FAM-TGCCTGGACCAAATCCCGGATACCTGAA3) was added to the PCR amplification. Repetitive cycles resulted in increasing release of fluorescence. System software used fluorescence intensity to determine mRNA levels in thrombopoietin and in glyceraldehyde-3-phosphate dehydrogenase (a housekeeping gene). Funding provided by the National Institutes of Health and Genentech. Inc., had no influence on design of the study, conduct of the study, or reporting of the findings. Results Selected patient characteristics are shown in the (Table 1). All patients had moderate-to-severe liver dysfunction. Thrombocytopenia was profound in most patients; 21 patients had platelet counts less than 50 000/L, and 6 patients had counts less than 30 000/L. All 17 patients had successful transplantation without serious complications. Liver biopsies were done approximately 8 days (range, 6 to 16 days) after transplantation. Results showed no evidence of acute rejection (11 patients), mild rejection (4 patients), or moderate rejection (2 patients). Preservation injury was mild to moderate in all 17 patients, and all 17 had improved liver function after transplantation (data not shown). Table 1. Patient Characteristics Baseline levels of thrombopoietin were undetectable in 39 of 43 patients with cirrhosis. The mean detectable level of thrombopoietin was 130 pg/mL in 5 patients, and all levels were less than 200 pg/mL. In patients who had orthotopic liver transplantation, the mean interval to first detection of thrombopoietin was about 3 days and peak levels occurred about 8 days after transplantation. Peak concentrations of thrombopoietin varied considerably (46 to 2541 pg/mL), with a mean peak value of 492 pg/mL (median, 339 pg/mL). Platelet counts increased during or immediately after peak concentrations of thrombopoietin. Thrombocytopenia completely resolved in all 17 patients within 23 days after transplantation (10 patients before discharge, and 7 patients after discharge). As platelet counts reached normal levels, most patients (8 of 10) developed low or undetectable levels of thrombopoietin. A representative graph of thrombopoietin levels and platelet counts in 1 patient who had orthotopic liver transplantation is shown in the (Figure 1). Figure 1. Serial thrombopoietin levels and platelet counts before and after orthotopic liver transplantation. The ratio of thrombopoietin mRNA transcript levels to glyceraldehyde-3-phosphate dehydrogenase mRNA transcript levels was 0.264 in cirrhotic liver samples and 0.357 in control liver samples. Results are expressed as ratios to control for the number of liver cells. Thrombopoietin mRNA transcript levels were 26% lower in cirrhotic liver samples than in control liver samples (unpaired t-test, P = 0.0103 [95% CI, 0.025 to 0.161]). Discussion The mechanism (or mechanisms) responsible for homeostasis of thrombopoietin has not been fully elucidated. One model proposes that regulation occurs solely through binding of thrombopoietin to receptors on platelets [13, 14]. Receptors have the ability to bind, internalize, and degrade thrombopoietin. When platelet counts are normal (>140 000/microL), most thrombopoietin is bound to receptors and plasma levels are low. When platelet counts are low (<140 000 cells/microL), few receptors are available for binding with thrombopoietin and plasma levels increase. Elevated levels of thrombopoietin then stimulate megakaryopoiesis and platelet production. This model establishes an inverse relation between thrombopoietin levels and platelet counts. We previously [11] reported undetectable levels of thrombopoietin (<160 pg/mL) in plasma in 88 of 89 healthy persons and markedly increased plasma thrombopoietin levels in 58 of 61 patients with cancer and thrombocytopenia (mean thrombopoietin level, 1095 pg/mL); these findings support an inverse relation. On the basis of this model, we expected elevated levels of thrombopoietin in cirrhotic patients who had thrombocytopenia. On the contrary, we found low or undetectable levels, which suggests that thrombopoietin levels and platelet counts are not inversely related in patients with cirrhosis. Several explanations may account for this. One hypothesis is that synthesis of thrombopoietin is impaired in cirrhotic livers. Defective production of thrombopoietin results in lower serum levels, decreased megakaryopoiesis, and lower platelet counts. Another explanation is that hypersplenism causes thrombocytopenia and production of thrombopoietin is normal. As a result, thrombopoietin is bound to platelets and both are sequestered in the spleen. The persistent thrombocytopenia found in patients with cirrhosis after splenectomy or portal decompression procedures argues against this explanation. A third possibility is that thrombopoietin levels and platelet counts are low because of rapid destruction of platelets. Low levels of thrombopoietin have been described in persons with idiopathic thrombocytopenic purpura [15]. The low levels probably result from binding thrombopoietin to platelets and subsequent rapid destruction of platelets (and thrombopoietin) in the spleen. Rapid destruction of platelets is unlikely in patients with cirrhosis because nuclear medicine studies of such patients [1] have demonstrated normal or only slightly decreased platelet survival. We did measure thrombopoietin levels in five patients who had cirrhosis and normal platelet c

3-D conformal HDR brachytherapy as monotherapy for localized prostate cancer. A pilot study.

Purpose:Pilot study to evaluate feasibility, acute toxicity and conformal quality of three-dimensional (3-D) conformal high-dose- rate (HDR) brachytherapy as monotherapy for localized prostate cancer using intraoperative real-time planning.Patients and Methods:Between 05/2002 and 05/2003, 52 patients with prostate cancer, prostate-specific antigen (PSA) ≤ 10 ng/ml, Gleason score ≤ 7 and clinical stage ≤ T2a were treated. Median PSA was 6.4 ng/ml and median Gleason score 5. 24/52 patients had stage T1c and 28/52 stage T2a. For transrectal ultrasound-(TRUS-)guided transperineal implantation of flexible plastic needles into the prostate, the real-time HDR planning system SWIFT® was used. After implantation, CT-based 3-D postplanning was performed. All patients received one implant for four fractions of HDR brachytherapy in 48 h using a reference dose (Dref) of 9.5 Gy to a total dose of 38.0 Gy. Dose-volume histograms (DVHs) were analyzed to evaluate the conformal quality of each implant using D90, D10 urethra, and D10 rectum. Acute toxicity was evaluated using the CTC (Common Toxicity Criteria) scales.Results:Median D90 was 106% of Dref (range: 93–115%), median D10 urethra 159% of Dref (range: 127–192%), and median D10 rectum 55% of Dref (range: 35–68%). Median follow-up is currently 8 months. In 2/52 patients acute grade 3 genitourinary toxicity was observed. No gastrointestinal toxicity > grade 1 occurred.Conclusion:3-D conformal HDR brachytherapy as monotherapy using intraoperative real-time planning is a feasible and highly conformal treatment for localized prostate cancer associated with minimal acute toxicity. Longer follow-up is needed to evaluate late toxicity and biochemical control.Ziel:Pilotstudie zur Evaluation der Praktikabilität, Akuttoxizität und konformalen Qualität der konformalen dreidimensionalen (3-D) High-Dose-Rate-(HDR-)Brachytherapie als Monotherapie beim lokal begrenzten Prostatakarzinom unter Einsatz intraoperativer Real-Time-Planung.Patienten und Methodik:Zwischen 05/2002 und 05/2003 wurden 52 Patienten mit einem Prostatakarzinom, PSA-Wert (prostataspezifisches Antigen) ≤ 10 ng/ml, Gleason-Score ≤ 7 und klinischem Stadium ≤ T2a behandelt. Der mediane PSA-Wert betrug 6,4 ng/ml und der mediane Gleason-Score 5. 24/52 Patienten waren im Stadium T1c und 28/52 im Stadium T2a. Für die TRUS-gesteuerte (transrektaler Ultraschall) transperineale Implantation von flexiblen Plastiknadeln in die Prostata kam das Real-Time- HDR-Planungssystem SWIFT® zum Einsatz. Nach der Implantation wurde ein CT-basiertes 3-D-Postplanning durchgeführt. Alle Patienten erhielten ein Implantat für vier Fraktionen HDR-Brachytherapie in 48 h mit einer Referenzdosis (Dref) von 9,5 Gy bis zu einer Gesamtdosis von 38,0 Gy. Dosis-Volumen-Histogramme (DVH) wurden analysiert, um die konformale Qualität der Implantate mit Berechnung der D90, D10 Urethra und D10 Rektum zu bestimmen. Akuttoxizitäten wurden unter Verwendung der CTC-Skalen (Common Toxicity Criteria) evaluiert.Ergebnisse:Die mediane D90 betrug 106% von Dref (Range: 93–115%), die mediane D10 Urethra 159% von Dref (Range: 127–192%), die mediane D10 Rektum 55% von Dref (Range: 35–68%). Die mediane Nachbeobachtungszeit beträgt gegenwärtig 8 Monate. Bei 2/52 Patienten wurden akute urogenitale Grad-3-Toxizitäten beobachtet. Gastrointestinale Toxizitäten > Grad 1 traten nicht auf.Schlussfolgerung:Die konformale 3-D-HDR-Brachytherapie als Monotherapie unter Einsatz intraoperativer Real-Time-Planung erweist sich als praktikable und hochkonformale Behandlung mit minimalen akuten Nebenwirkungen beim lokal begrenzten Prostatakarzinom. Eine längere Nachbeobachtungszeit ist zur Beurteilung von Spättoxizitäten und biochemischer Kontrolle notwendig.

Carfilzomib in multiple myeloma patients with renal impairment: Pharmacokinetics and safety

This phase 2 study assessed the safety, pharmacokinetics, pharmacodynamics and efficacy of carfilzomib, a selective proteasome inhibitor, in patients with multiple myeloma and varying degrees of renal impairment, including patients on chronic hemodialysis. Patients were grouped by creatinine clearance: >80 ml/min, 50–80 ml/min, 30–49 ml/min, <30 ml/min and chronic hemodialysis. Carfilzomib was administered on days 1, 2, 8, 9, 15 and 16 in 28-day cycles: 15 mg/m2 (Cycle 1), 20 mg/m2 (Cycle 2) and 27 mg/m2 (Cycles 3+). There were no differences in carfilzomib clearance or exposure among patients with normal renal function and any group with renal impairment. Grade 3/4 adverse events (AEs) included anemia (28.0%), thrombocytopenia (20.0%), lymphopenia (18.0%) and fatigue (14.0%). AEs were similar among groups. At 15 mg/m2, proteasome inhibition up to 85% was observed and did not differ among groups. Although nearly 50% of patients were refractory to both bortezomib and lenalidomide, end of study partial response or better (overall response rate) was 25.5% with 7.9 months median duration of response. In conclusion, the pharmacokinetics and safety of carfilzomib were not influenced by the degree of baseline renal impairment, including in patients on dialysis, and carfilzomib was well tolerated and demonstrated promising efficacy.

Phase 2 dose-expansion study (PX-171-006) of carfilzomib, lenalidomide and low-dose dexamethasone in relapsed or progressive multiple myeloma

We previously reported a phase 1b dose-escalation study of carfilzomib, lenalidomide, and low-dose dexamethasone (CRd) in relapsed or progressive multiple myeloma where the maximum planned dose (MPD) was carfilzomib 20 mg/m2 days 1 and 2 of cycle 1 and 27 mg/m2 days 8, 9, 15, 16, and thereafter; lenalidomide 25 mg days 1 to 21; and dexamethasone 40 mg once weekly on 28-day cycles. Herein, we present results from the phase 2 dose expansion at the MPD, focusing on the 52 patients enrolled in the MPD cohort. Median follow-up was 24.4 months. In the MPD cohort, overall response rate (ORR) was 76.9% with median time to response of 0.95 month (range, 0.5-4.6) and duration of response (DOR) of 22.1 months. Median progression-free survival was 15.4 months. ORR was 69.2% in bortezomib-refractory patients and 69.6% in lenalidomide-refractory patients with median DOR of 22.1 and 10.8 months, respectively. A median of 9.5 (range, 1-45) carfilzomib cycles were started with 7.7% of patients requiring carfilzomib dose reductions and 19.2% discontinuing CRd due to adverse events (AEs). Grade 3/4 AEs included lymphopenia (48.1%), neutropenia (32.7%), thrombocytopenia (19.2%), and anemia (19.2%). CRd at the MPD was well tolerated with robust, rapid, and durable responses.

Perifosine Plus Bortezomib and Dexamethasone in Patients With Relapsed/Refractory Multiple Myeloma Previously Treated With Bortezomib: Results of a Multicenter Phase I/II Trial

PURPOSE Novel agents have improved patient outcome in relapsed or relapsed/refractory multiple myeloma (MM). Preclinical data show that the novel signal transduction modulator, perifosine, enhances the cytotoxicity of dexamethasone and bortezomib. Clinical data suggest that perifosine in combination with dexamethasone has activity in relapsed or relapsed/refractory MM. PATIENTS AND METHODS In a phase I/II study, perifosine in combination with bortezomib with or without dexamethasone was prospectively evaluated in 84 patients with relapsed or relapsed/refractory MM. All were heavily pretreated and bortezomib exposed; 73% were refractory to bortezomib, and 51% were refractory to bortezomib and dexamethasone. The dose selected for the phase II study was perifosine 50 mg/d plus bortezomib 1.3 mg/m(2), with the addition of low-dose dexamethasone at 20 mg if progression occurred on perifosine plus bortezomib alone. RESULTS An overall response rate (ORR; defined as minimal response or better) of 41% was demonstrated with this combination in 73 evaluable patients, including an ORR of 65% in bortezomib-relapsed patients and 32% in bortezomib-refractory patients. Therapy was generally well tolerated; toxicities, including gastrointestinal adverse effects and fatigue, proved manageable. No treatment-related mortality was seen. Median progression-free survival was 6.4 months, with a median overall survival of 25 months (22.5 months in bortezomib-refractory patients). CONCLUSION Perifosine-bortezomib ± dexamethasone demonstrated encouraging activity in heavily pretreated bortezomib-exposed patients with advanced MM. A phase III trial is underway comparing perifosine-bortezomib plus dexamethasone with bortezomib-dexamethasone in patients with relapsed/refractory MM previously treated with bortezomib.

High-Dose-Rate Interstitial Brachytherapy as Monotherapy for Clinically Localized Prostate Cancer: Treatment Evolution and Mature Results

PURPOSE To report the clinical outcome of high-dose-rate (HDR) interstitial (IRT) brachytherapy (BRT) as sole treatment (monotherapy) for clinically localized prostate cancer. METHODS AND MATERIALS Between January 2002 and December 2009, 718 consecutive patients with clinically localized prostate cancer were treated with transrectal ultrasound (TRUS)-guided HDR monotherapy. Three treatment protocols were applied; 141 patients received 38.0 Gy using one implant in 4 fractions of 9.5 Gy with computed tomography-based treatment planning; 351 patients received 38.0 Gy in 4 fractions of 9.5 Gy, using 2 implants (2 weeks apart) and intraoperative TRUS real-time treatment planning; and 226 patients received 34.5 Gy, using 3 single-fraction implants of 11.5 Gy (3 weeks apart) and intraoperative TRUS real-time treatment planning. Biochemical failure was defined according to the Phoenix consensus, and toxicity was evaluated using Common Toxicity Criteria for Adverse Events version 3. RESULTS The median follow-up time was 52.8 months. The 36-, 60-, and 96-month biochemical control and metastasis-free survival rates for the entire cohort were 97%, 94%, and 90% and 99%, 98%, and 97%, respectively. Toxicity was scored per event, with 5.4% acute grade 3 genitourinary and 0.2% acute grade 3 gastrointestinal toxicity. Late grade 3 genitourinary and gastrointestinal toxicities were 3.5% and 1.6%, respectively. Two patients developed grade 4 incontinence. No other instance of grade 4 or greater acute or late toxicity was reported. CONCLUSION Our results confirm IRT-HDR-BRT is safe and effective as monotherapy for clinically localized prostate cancer.