Vladislav Yu. Kudrya

Electronic Excitation Energy Transfer in DNA. Nature of Triplet Excitations Capturing Centers

Spectral properties, energy structure, and electronic processes in DNA, poly(dAdT)2, d(CCCGGGTTTAAA), d(ATC), d(AT), dGMP, dAMP, dCMP, dTMP were studied. The DNA lowest excited electronic singlet and triplet levels are connected with guanine and adenine bases, correspondingly. The DNA fluorescence is close to a linear combination of the guanine and cytidine emissions and connected, to a greater extent, with the singlet energy transfer to these bases. The origin of the DNA phosphorescence is associated with AT-sequences that are traps of triplet excitations in DNA. The triplet energy transfer to these centers and adenine bases (that are most photostable) leads to the DNA self-protection against a damage induced by electronic excitations of DNA.

Multifunctional Macromolecules and Structures as One-Way Exciton Conductors

Abstract The first steps in the design, investigations and possible applications of multifunctional macromolecules exhibiting one-way direct exciton conductivity are presented. Some problems that appeared during the formation of these systems are discussed.

The Peculiarities of the RNA Luminescence

The optical absorption, fluorescence and phosphorescence spectra of the RNA and ribonucleotides are investigated. Positions of the first excited singlet and triplet electronic energy levels of the RNA bases are evaluated. It is shown the energy structure of the RNA is determined mainly by the individual properties of the ribonucleotides π-electron systems. Comparing the phosphorescence spectra of the DNA, RNA and ribonucleotides two types of triplet excitations traps in the RNA are found: (1) adenosine groups and (2) the centers of unknown nature that manifest structureless long-wave phosphorescence and are not the same as for the DNA.

The optical biomedical sensors for the DNA detection and imaging based on two-photon excited luminescent styryl dyes. Phototoxic influence on the DNA

The optical absorption, fluorescence and phosphorescence of the novel styryl dyes developed for the fluorescent detection of DNA were investigated. The energy structures of dye molecules as well as spectral manifestations of the dyes aggregate formation and interaction with DNA were studied. The dramatic increase (up to 1000 times) of the fluorescence intensity of dyes in the presence of DNA was observed. The photostability and phototoxic influence on the DNA of several styryl dyes were studied by analyzing absorption, fluorescence and phosphorescence spectra of these dyes and dye-DNA systems. Changes of the optical density value of dye-DNA solutions caused by the visible light irradiation were fixed in the wavelength regions of the DNA absorption and of the dye absorption. Fluorescence emission of dye-DNA complexes upon two-photon excitation (TPE) at wavelength 1064 nm with the 20 ns pulsed YAG: Nd3+ laser and at 840 nm with the 90 fs pulsed Ti:sapphire laser was registered. The values of two-photon absorption cross-sections of dye-DNA complexes were evaluated.

The peculiarities of sorbtion mechanism of phenole molecules by films of PVA-PAAN interpolymer complex

The peculiarities of sorption mechanism of phenole molecules by poly(vinylalcohol) and poly(acrylamide) (PVA-PAA N ) films are examined. An analytical model of absorption process based on diffusive character of penetration of phenole molecules in polymer film with the following spontaneous capturing by selftuning traps is proposed. The analytical results can be easy compared with experimental data obtained by spectrophotometry method. The comparison of theory and experiment gives the average value of resulting diffusion lenght of phenole molecule during «free» life-time ∼10 -6 cm.

Synthetic and Biological Functional Compounds with Direct Excitons Conductivity for Nanoelectronic Devices

The design, synthesis, and investigations of the special functional compounds containing several (up to 12) π-electron systems are done. The results of spectral investigations of the synthetic nucleotides-containing compounds are compared with the results obtained on DNA. The predicted processes of transfer of direct triplet electronic excitations in all the investigated functional compounds are proved. This fact gives the possibility to propose these compounds to be used for the design of nanoelectronic devices. The computer simulations of electronic excitations passing through an oligomer functional macromolecule taking into account the reverse exciton currents and the multipath excitation energy migration show these macromolecular compounds are perspective to be applied in nanoelectronics.

Space configuration and luminescence properties of polyphosphazenes with carbazole-containing side groups

Abstract The absorption, fluorescence and phosphorescence of two novel polyorganophosphazenes containing separated carbazole side groups, a polymer chain with spacers (Pf2-sep) and without spacer (Pf2-conj), were studied. It was shown that spectral properties of the Pf2-sep polymer are connected mainly with optical transitions in individual carbazole chromophores. The optical properties of the Pf2-conj polymer are rather different compared to the Pf2-sep. That is caused by perturbation of the carbazole groups electron system by phosphor atoms and the influence of the carbazole groups (belonging to the same unit) on each other. This perturbation takes place under special relative geometrical displacement of carbazole and phosphor atoms.

The spectral properties of DNA and RNA macromolecules at low temperatures: fundamental and applied aspects.

This paper summarizes the results of studies of the spectral properties-optical absorption, fluorescence and phosphorescence-of DNA and RNA macromolecules and synthetic poly-, oligo- and mono-nucleotides, which have been carried out in our laboratory. The system of first excited singlet and triplet energy levels for DNA and RNA is evaluated using low-temperature (4.2 K-77 K) luminescent measurements. The traps of the singlet and triplet electronic excitations in these compounds are identified. An important self-protection mechanism against photo-damage of DNA and RNA by UV photons or penetrative radiation based on the capture of triplet electronic-energy excitations by the most photostable centers-in DNA, the complex formed by neighboring adenosine (A) and thymidine (T) links; in RNA, the adenosine links-is described. It is confirmed that despite similarities in the chemical and partly energy structures DNA is more stable than RNA. The spectral manifestation of the telomeres (the important functional system) in DNA macromolecules is examined. The results obtained on telomere fragments provide the possibility of finding the configuration peculiarities of the triplet excitations traps in DNA macromolecules. The resulting spreading length of the migrating singlet (l s) and triplet (l t) excitations for DNA and RNA macromolecules are evaluated.

Some functional macromolecules as exciton converters

The hypothetical structures of macromolecules with direct one-way excitonic conductivity have been examined. The dependence of excitonic current value on number of polymers cell has been obtained for macromolecules of optimal energetical structure. Some compounds with direct exciton conductivity were designed and synthesized. Such compounds may be used as exciton convectors in nanoelectronics.

Luminescence of telomeric fragments of DNA macromolecule

ABSTRACT Optical absorption, fluorescence and phosphorescence spectra of the telomere fragment d(AGGGTTAGGGTTAGGGTTAGGG) (Tel22) were studied and compared with those of the native DNA. Main centers of optical absorption in telomeres are A, T and G nucleic bases and G-quadruplexes. The fluorescence of telomeres is associated mainly with G-bases and other long-wave centers, possibly G-quadruplex structures, whereas their phosphorescence is associated with AT-sequences as it takes place for the native DNA. A significant increase of phosphorescence-to-fluorescence intensity ratio was observed for Tel22 as compared to DNA. Results obtained are promising for the detection of DNA macromolecules containing the extended telomeric sequences.