Xiangshan Zhou

Decrease of proteolytic degradation of recombinant hirudin produced by Pichia pastoris by controlling the specific growth rate

The effects of the specific growth rate and methanol concentration on the degradation of hirudin produced by recombinant Pichia pastoris were investigated. When a methanol-limited state and the specific growth rate of 0.02 h−1 were maintained during the fermentation, a minimum degradation of hirudin and a maximum specific hirudin production rate were achieved. By this strategy, the production of intact recombinant hirudin Hir65 reached 0.7 g l−1 in fed-batch fermentation. Its proportion was 35% to all forms of hirudin.

An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris

Alcohol oxidase I gene (AOX1) promoter (P(AOX1)) is a key promoter in the methylotrophic yeast Pichia pastoris. To identify the cis-acting element in the AOX1 promoter, we constructed expression plasmids in which the green fluorescent protein (GFP) gene coding region was fused to a series of internal deletion mutants of the AOX1 promoter. By analyzing the expression and transcription level of GFP by each plasmid, we identified a positive cis-element, Region D, which is located between positions -638 and -510 of the AOX1 promoter. This region contains an invert repeat-like sequence GTGGGGTCAAATAGTTTCATGTTCCCCAA that is similar to the upstream activation sequence 1 (UAS1) of alcohol dehydrogenase II gene (ADH2) in Saccharomyces cerevisiae. The inverted repeat sequence in the UAS1 is known to contain the binding site for alcohol dehydrogenase II synthesis regulator (Adr1p). When three tandem copies of Region D were inserted into the Region D-deleted AOX1 promoter, the expression of GFP at the protein level and the mRNA level increased to 157% and 135% of the wild type, respectively. An electrophoretic mobility shift assay indicated that Region D could form a DNA-protein complex with cell extracts under methanol-induced and glucose/methanol-repressed conditions. These data suggest that Region D may function as a cis-acting regulatory element in the AOX1 promoter to positively regulate the expression of AOX1.

Catabolite Repression of Aox in Pichia pastoris Is Dependent on Hexose Transporter PpHxt1 and Pexophagy

ABSTRACT In this work, the identification and characterization of two hexose transporter homologs in the methylotrophic yeast Pichia pastoris, P. pastoris Hxt1 (PpHxt1) and PpHxt2, are described. When expressed in a Saccharomyces cerevisiae hxt-null mutant strain that is unable to take up monosaccharides, either protein restored growth on glucose or fructose. Both PpHXT genes are transcriptionally regulated by glucose. Transcript levels of PpHXT1 are induced by high levels of glucose, whereas transcript levels of PpHXT2 are relatively lower and are fully induced by low levels of glucose. In addition, PpHxt2 plays an important role in glycolysis-dependent fermentative growth, since PpHxt2 is essential for growth on glucose or fructose when respiration is inhibited. Notably, we firstly found that the deletion of PpHXT1, but not PpHXT2, leads to the induced expression of the alcohol oxidase I gene (AOX1) in response to glucose or fructose. We also elucidated that a sharp dropping of the sugar-induced expression level of Aox at a later growth phase is caused mainly by pexophagy, a degradation pathway in methylotrophic yeast. The sugar-inducible AOX1 promoter in an Δhxt1 strain may be promising as a host for the expression of heterologous proteins. The functional analysis of these two hexose transporters is the first step in elucidating the mechanisms of sugar metabolism and catabolite repression in P. pastoris.

Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 (AOX1) Promoter in Pichia pastoris

The alcohol oxidase 1 (AOX1) promoter (PAOX1) of Pichia pastoris is the most powerful and commonly used promoter for driving protein expression. However, mechanisms regulating its transcriptional activity are unclear. Here, we identified a Zn(II)2Cys6-type methanol-induced transcription factor 1 (Mit1) and elucidated its roles in regulating PAOX1 activity in response to glycerol and methanol. Mit1 regulated the expression of many genes involved in methanol utilization pathway, including AOX1, but did not participate in peroxisome proliferation and transportation of peroxisomal proteins during methanol metabolism. Structural analysis of Mit1 by performing domain deletions confirmed its specific and critical role in the strict repression of PAOX1 in glycerol medium. Importantly, Mit1, Mxr1, and Prm1, which positively regulated PAOX1 in response to methanol, were bound to PAOX1 at different sites and did not interact with each other. However, these factors cooperatively activated PAOX1 through a cascade. Mxr1 mainly functioned during carbon derepression, whereas Mit1 and Prm1 functioned during methanol induction, with Prm1 transmitting methanol signal to Mit1 by binding to the MIT1 promoter (PMIT1), thus increasingly expressing Mit1 and subsequently activating PAOX1.

Highly sialylated recombinant human erythropoietin production in large‐scale perfusion bioreactor utilizing CHO‐gmt4 (JW152) with restored GnT I function

Therapeutic glycoprotein drugs require a high degree of sialylation of their N‐glycans for a better circulatory half‐life that results in greater efficacy. It has been demonstrated that Chinese hamster ovary (CHO) glycosylation mutants lacking N‐acetylglucosaminyltransferase I (GnT I), when restored by introduction of a functional GnT I, produced highly sialylated erythropoietin (EPO). We have now further engineered one of such mutants, JW152, by inactivating the dihydrofolate reductase (DHFR) gene to allow for the amplification of the EPO gene with methotrexate (MTX). Several MTX‐amplified clones maintained the ability to produce highly sialylated EPO and one was selected for culture in a perfusion bioreactor that is used in an existing industrial EPO‐production bioprocess. Extensive characterization of the EPO produced was performed using total sialic quantification, HPAEC‐PAD and MALDI‐TOF MS analyses. Our results demonstrated that the EPO produced by the mutant line exhibits superior sialylation compared to the commercially used EPO‐producing CHO clone cultured under the same conditions. Therefore, this mutant has the industrial potential for producing highly sialylated recombinant EPO and potentially other recombinant glycoprotein therapeutics.

Identified biosynthetic pathway of aspergiolide A and a novel strategy to increase its production in a marine-derived fungus Aspergillus glaucus by feeding of biosynthetic precursors and inhibitors simultaneously

Aspergiolide A is a novel anti-tumor anthraquinone derivant produced by marine-derived fungus Aspergillus glaucus. To identify its biosynthetic pathway and further improve the production, the effects of biosynthetic pathway specific inhibitors and precursors were investigated. Cerulenin and iodoacetamide, the specific inhibitors of polyketide pathway, could completely inhibit the aspergiolide A accumulation. Putative precursors of polyketide pathway could increase aspergiolide A production greatly, such as 6 mM acetate increased production by 135%. Simvastatin and citrate, the inhibitors of mevalonate pathway, stimulated the production by 63% and 179%, respectively. Considering that acetyl-CoA is the common starter unit in both polyketide and mevalonate pathway, a novel strategy was designed to stimulate the aspergiolide A accumulation. Combinations of 12 mM acetate with 0.3 mM simvastatin could increase the production by 151%, while the supplementation with 12 mM acetate and 12 mM citrate brought a 262% increase of aspergiolide A production. The strategy might be very useful to enhance the production of other secondary metabolites derived from polyketide pathway.

Methanol-Independent Protein Expression by AOX1 Promoter with trans -Acting Elements Engineering and Glucose-Glycerol-Shift Induction in Pichia pastoris

The alcohol oxidase 1 promoter (PAOX1) of Pichia pastoris is commonly used for high level expression of recombinant proteins. While the safety risk of methanol and tough process control for methanol induction usually cause problems especially in large-scale fermentation. By testing the functions of trans-acting elements of PAOX1 and combinatorially engineering of them, we successfully constructed a methanol-free PAOX1 start-up strain, in which, three transcription repressors were identified and deleted and, one transcription activator were overexpressed. The strain expressed 77% GFP levels in glycerol compared to the wide-type in methanol. Then, insulin precursor (IP) was expressed, taking which as a model, we developed a novel glucose-glycerol-shift induced PAOX1 start-up for this methanol-free strain. A batch phase with glucose of 40 g/L followed by controlling residual glucose not lower than 20 g/L was compatible for supporting cell growth and suppressing PAOX1. Then, glycerol induction was started after glucose used up. Accordingly, an optimal bioprocess was further determined, generating a high IP production of 2.46 g/L in a 5-L bioreactor with dramatical decrease of oxygen consumption and heat evolution comparing with the wild-type in methanol. This mutant and bioprocess represent a safe and efficient alternative to the traditional glycerol-repressed/methanol-induced PAOX1 system.

Enhancing aspergiolide A production from a shear-sensitive and easy-foaming marine-derived filamentous fungus Aspergillus glaucus by oxygen carrier addition and impeller combination in a bioreactor.

Production enhancement of a novel antitumor compound aspergiolide A from shear-sensitive and easy-foaming marine-derived fungus Aspergillus glaucus HB1-19 in a 5-l stirred bioreactor was investigated. Two types of impellers, i.e., six-flat-blade disc turbine impeller (DT) and three-sector-blade pitched blade turbine impeller (PB) were used in this work. In cultures with fermentation medium, the combination of upper PB and lower DT led to the maximum dry biomass (13.8 g/l) and aspergiolide A production (19.3 mg/l). However, two PBs brought the highest aspergiolide A yield coefficient (1.9 mg/g dry biomass) despite it produced the lowest dry biomass (5.3 g/l). By contrast, two DTs and the upper DT and lower PB showed insignificant results. Feeding 0.35% (v/v) n-dodecane in cultures with upper PB and lower DT further improved aspergiolide A production by 31.0%, i.e., 25.3 mg/l, which is also 322% higher than that in the ordinary cultures with two DTs.

Efficient strategy for enhancing aspergiolide A production by citrate feedings and its effects on sexual development and growth of marine-derived fungus Aspergillus glaucus.

Aspergiolide A production enhancement by citrate and its effects on growth and sexual development of marine-derived fungus Aspergillus glaucus HB1-19 were investigated. In agar plate culture, 15 mM citric acid decreased colony radial growth and aspergiolide A production by 31.5% and 23.0%, respectively. It also improved sexual cleistothecium formation by 360% but depressed asexual conidiospore generation by 84.8%. In submerged culture, adding 40 mM citric acid finally promoted aspergiolide A production by 80.0%, which accompanied with 16.7% increase of biomass and 10.0% enhancement of sugar utilization. Differently, sodium citrate made no obvious or even opposite effects. Citrate and low pH could significantly improve pyruvate accumulation but inhibit succinate and fumarate production. Moreover, low pH was favorable to citrate utilization. Organic acids changes were closely related to aspergiolide A biosynthesis. Comparing to pH controls, effects of citric acid comprised pH decrease solicitation and citrate utilization enhancement.

Characterization of a thermostable raw-starch hydrolyzing α-amylase from deep-sea thermophile Geobacillus sp.

A deep-sea thermophile, Geobacillus sp. 4j, was identified to grow on starch and produce thermostable amylase. N-terminally truncated form of Geobacillus sp. 4j α-amylase (Gs4j-amyA) was fused at its N-terminal end with the signal peptide of outer membrane protein A (OmpA) of Escherichia coli. The enzyme was over-expressed in E. coli BL21 with a maximum extracellular production of 130U/ml in shake flask. The yield of the transformant increased 22-fold as compared with that of the wild strain. The recombinant enzyme purified to apparent homogeneity by metal-affinity chromatography, exhibited a molecular mass of 62kDa. It displayed the maximal activity at 60-65°C and pH 5.5. Its half-life (t1/2) at 80°C was 4.25h with a temperature deactivation energy of 166.3kJ/mol. Compared to three commonly used commercial α-amylases, the Gs4j-amyA exhibited similar thermostable performance to BLA but better than BAA and BSA. It also showed a universally efficient raw starch hydrolysis performance superior to commercial α-amylases at an acidic pH approaching nature of starch slurry. As a new acidic-resistant thermostable α-amylase, it has the potential to bypass the industrial gelatinization step in raw starch hydrolysis.