Yasuhide Hirota

A New Water‐soluble Camptothecin Derivative, DX‐8951f, Exhibits Potent Antitumor Activity against Human Tumors in vitro and in vivo

CPT‐11, a semisynthetic derivative of camptothecin, exhibited strong antitumor activity against lymphoma, lung cancer, colorectal cancer, gastric cancer, ovarian cancer, and cervical cancer. CPT‐11 is a pro‐drug that is converted to an active metabolite, SN‐38, in vivo by enzymes such as carboxylesterase. We synthesized a water‐soluble and non‐pro‐drug analog of camptothecin, DX‐8951f. It showed both high in vitro potency against a series of 32 malignant cell lines and significant topoisomerase I inhibition. The anti‐proliferative activity of DX‐8951f, as indicated by the mean GI50 value, was about 6 and 28 times greater than that of SN‐38 or SK&F 10486‐A (Topotecan), respectively. These three derivatives of camptothecin showed similar patterns of differential response among 32 cell lines, that is, their spectra of in vitro cytotoxicity were almost the same. The antitumor activity of three doses of DX‐8951f administered i.v. at 4‐day intervals against human gastric adenocarcinoma SC‐6 xenografts was greater than that of CPT‐11 or SK&F 10486‐A. Moreover, it overcame P‐glycoprotein‐mediated multi‐drug resistance. These data suggest that DX‐8951f has a high antitumor activity and is a potential therapeutic agent.

Inhibitory Activity of Camptothecin Derivatives Against Acetylcholinesterase in Dogs and Their Binding Activity to Acetylcholine Receptors in Rats

Abstract— A camptothecin derivative, 7‐ethyl‐10‐[4‐(1‐piperidino)‐1‐piperidino]carbonyloxycamptothecin (CPT‐11), shows a potent antitumour activity in experimental tumour models and in clinical trials. However, CPT‐11 induced early diarrhoea and vomiting at high dose levels in clinical studies and showed an acetylcholine‐like action on the guinea‐pig ileum and trachea. In the present study, we investigated the activities of camptothecin derivatives in inhibiting acetylcholinesterase (AChE) and in binding to muscarinic acetylcholine receptors (AChR). CPT‐11 inhibited AChE and binding of the specific ligand to AChR with respective 50% inhibition concentrations of 0·2 and 5 μm. These inhibitions were induced by camptothecin derivatives having an amino group at the C‐10 position (or the C‐4 position of hexacyclic derivatives), but were not or were only slightly induced by the others. Early defecation and vomiting in dogs were observed after intravenous injection of DU‐6596 and DU‐6888, two hexacyclic derivatives having the aminomethyl group at the C‐4 position, and of CPT‐11. DU‐6174, however, which has a hydroxy group at this position, induced no early defecation and little vomiting. Plasma concentrations of CPT‐11, DU‐6596 and DU‐6888 after intravenous treatment at doses causing such early adverse effects were maintained for 1 h or longer at levels sufficient to inhibit AChE. These results suggest that the inhibition of AChE by camptothecin derivatives with an amino group at the C‐10 position (or the C‐4 position) relates to the early defecation or diarrhoea and vomiting.

Deoxyribonucleoside-triphosphate imbalance death: Deoxyadenosine-induced dNTP imbalance and DNA double strand breaks in mouse FM3A cells and the mechanism of cell death

The mechanism of deoxyadenosine (dAdo)-induced death of mouse mammary tumor FM3A cells was studied. When the cells were exposed to dAdo at 3 mM, an imbalance of intracellular dNTP pool resulted: dATP concentration was elevated 100-fold and the dGTP concentration was reduced to less than 1% of the control values. The imbalance was followed by breakage of mature DNA. DNA double strand breaks were observed in the dAdo treated cells 12 hr after the administration. We assume that the double strand breaks play an important role in the process of the dAdo-mediated cell death, and that the intracellular dNTP imbalance is the trigger of these events.

p53 Antisense Oligonucleotide Inhibits Growth of Human Colon Tumor and Normal Cell Lines

We examined the relationship between the expression of mutant p53 proteins and tumor cell growth using a p53 antisense oligonucleotide (5′‐CCCTGCTCCCCCCTGGCTCC‐3′). The oligonucleotide inhibited the growth of three human colon tumor cell lines (DLD‐1, SW620 and WiDr), which produce only mutant p53 proteins with different mutation sites. Treatment of DLD‐1 cells with the p53 antisense oligonucleotide caused a decrease in the level of p53 mutant protein. Synthesis of DNA in DLD‐1 and SW620 cells was inhibited more potently than that of RNA or protein after antisense treatment. Furthermore, these cells were accumulated in the S phase when DNA synthesis was inhibited. Meanwhile, the antisense oligonucleotide also inhibited the growth of three human normal cell lines (WI‐38, TIG‐1 and Intestine 407). While treatment of WI‐38 and TIG‐1 cells with the antisense oligonucleotide inhibited synthesis of DNA more potently than that of RNA or protein, these normal cells were accumulated in the G0/G1 phase. These results suggest that p53 proteins, either with or without mutation, play a pivotal role in the growth of tumor and normal cells, but that mutant and wild‐type p53 proteins may function differently in cell growth.

Imbalance of Deoxyribonucleoside Triphosphates and DNA Double-strand Breaks in Mouse Mammary Tumor FM3A Cells Treated in vitro with an Antineoplastic Tropolone Derivative

The mechanism by which α,α‐bis(2‐hydroxy‐6‐isopropyltropon‐3‐yl)‐4‐methoxytoluene (JCI‐3661) kills mouse mammary tumor FM3A (F28–7) cells was studied. When the cells were exposed to the drug at 3.7 μM, the intracellular dNTP pool became unbalanced because of decreases in dGTP and dATP and an increase in dTTP. The pattern of the dNTP imbalance was the same as that caused by hydroxyurea. When JCI‐3661 was added to the culture medium, mature DNA strands broke, giving fragments of 100–200 kilobase pairs long as found by orthogonal‐field‐alternation gel electrophoresis. DNA strand breaks, detected by this technique, were observed in the cells at 12 h after the addition. The beginning of cell death was observed at about 14 h (trypan blue staining) or at about 12 h (colony‐forming ability) after cultivation Breaks in the single and double strands of DNA, as measured by alkaline and neutral filter elution assay, became evident 24 h after treatment with 3.7 μM JCI‐3661. Comparison of the ratio of single‐ and double‐strand breaks caused by JCI‐3661 to that following radiation suggested that JCI‐3661 broke only double strands. Cycloheximide inhibited both the breakage of double strands and the cell death caused by JCI‐3661. JCI‐3661 decreased DNA synthesis more than RNA or protein synthesis. The breaks in double strands of DNA were probably important in the cell death caused by JCI‐3661.

Different Mechanisms of Inhibition of DNA Synthesis by (E)-5-(2-Bromovinyl)-2′-deoxyuridine in Cells Transfected with Gene for Thymidine Kinase of Herpes Simplex Virus Type 1 and in Cells Infected with the Virus

Abstract The effect of (E)-5-(2-bromovinyl)-2′-deoxyuridine (BVDU) on deoxyribonucleoside 5′-triphosphate pools was studied in cells transfected with gene for thymidine kinase of herpes simplex virus type 1 and cells infected with the virus. When infected cells were treated with BVDU, the triphosphate form of the nucleoside analog was detected. When transfected cells were treated with BVDU, the triphosphate form was not detected and the pattern of changes in the pools was the same as after 5-fluoro-2′-deoxyuridine treatment. BVDU seems to inhibit DNA synthesis differently in the two cell lines and nucleotide metabolism in the transfected cells was not the same as in the infected cells.

172 THE MECHANISM OF 2-CHLORODEOXYADENOSINE-INDUCED CELL DEATH

The in vitro cytotoxities of 2-chlorodeoxyadenosine (2-CldAdo) were tested using 35 different lines of human leukemia-lymphoma cells. 2-CldAdo was found to be broadly cytotoxic to human T-(EC50 value: 0.005-5.3 μM), B-(0.015-4,8 μM), myeloblatic (0.009-12 μM), and monocytic (2.6-5.4 μM) cell lines. The mechanism of cytotoxic action of 2-CldAdo in CCRF-HSB2 cells was investigated. We observed the 2-CldAdo-induced imbalance of intracellular deoxyribonucleoside triphosphate(dNTP) pool and subsequent double strand breaks in mature DNA, accompanied by cell death. When the cells were exposed to 2-CldAdo at 1 μM, an imbalabce of dNTP pool resulted: a depletion of dCTP, dATP and dGTP was observed. Within 4hr of treatment dCTP pool size became smaller than the lower limit of measurement. The loss of cell viability occurred at about 12 hr. Cycloheximide inhibited both the production of double strand breaks and 2-CldAdo-mediated cell death. We assume that the double strand breaks play an important role in the process of 2-CldAdo-mediated cell death and the intracellular dNTP imbalance is the trigger of these events.