Yunyun Zhuang

The Symbiodinium kawagutii genome illuminates dinoflagellate gene expression and coral symbiosis

Symbionts are adapted to work with corals Many corals have formed mutualistic associations with dinoflagellate symbionts, which are thought to provide nutrients and other benefits. To examine the underlying genetics of this association, S. Lin et al. sequenced the genome of the endosymbiont dinoflagellate Symbiodinium kawagutii. The genome includes gene number expansions and encodes microRNAs that show complementarity to genes within the coral genome. Such microRNAs may be involved in regulating coral genes. Furthermore, coral and S. kawagutii appear to share homologs of genes encoding specific nutrient transporters. The findings shed light on how symbiosis is established and maintained between dinoflagellates and corals. Science, this issue p. 691 The genome of the coral symbiont Symbiodinium reveals fundamental aspects of the coral-alga symbiosis. Dinoflagellates are important components of marine ecosystems and essential coral symbionts, yet little is known about their genomes. We report here on the analysis of a high-quality assembly from the 1180-megabase genome of Symbiodinium kawagutii. We annotated protein-coding genes and identified Symbiodinium-specific gene families. No whole-genome duplication was observed, but instead we found active (retro)transposition and gene family expansion, especially in processes important for successful symbiosis with corals. We also documented genes potentially governing sexual reproduction and cyst formation, novel promoter elements, and a microRNA system potentially regulating gene expression in both symbiont and coral. We found biochemical complementarity between genomes of S. kawagutii and the anthozoan Acropora, indicative of host-symbiont coevolution, providing a resource for studying the molecular basis and evolution of coral symbiosis.

Spliced leader–based metatranscriptomic analyses lead to recognition of hidden genomic features in dinoflagellates

Environmental transcriptomics (metatranscriptomics) for a specific lineage of eukaryotic microbes (e.g., Dinoflagellata) would be instrumental for unraveling the genetic mechanisms by which these microbes respond to the natural environment, but it has not been exploited because of technical difficulties. Using the recently discovered dinoflagellate mRNA-specific spliced leader as a selective primer, we constructed cDNA libraries (e-cDNAs) from one marine and two freshwater plankton assemblages. Small-scale sequencing of the e-cDNAs revealed functionally diverse transcriptomes proven to be of dinoflagellate origin. A set of dinoflagellate common genes and transcripts of dominant dinoflagellate species were identified. Further analyses of the dataset prompted us to delve into the existing, largely unannotated dinoflagellate EST datasets (DinoEST). Consequently, all four nucleosome core histones, two histone modification proteins, and a nucleosome assembly protein were detected, clearly indicating the presence of nucleosome-like machinery long thought not to exist in dinoflagellates. The isolation of rhodopsin from taxonomically and ecotypically diverse dinoflagellates and its structural similarity and phylogenetic affinity to xanthorhodopsin suggest a common genetic potential in dinoflagellates to use solar energy nonphotosynthetically. Furthermore, we found 55 cytoplasmic ribosomal proteins (RPs) from the e-cDNAs and 24 more from DinoEST, showing that the dinoflagellate phylum possesses all 79 eukaryotic RPs. Our results suggest that a sophisticated eukaryotic molecular machine operates in dinoflagellates that likely encodes many more unsuspected physiological capabilities and, meanwhile, demonstrate that unique spliced leaders are useful for profiling lineage-specific microbial transcriptomes in situ.

High-Level Diversity of Dinoflagellates in the Natural Environment, Revealed by Assessment of Mitochondrial cox1 and cob Genes for Dinoflagellate DNA Barcoding†

ABSTRACT DNA barcoding is a diagnostic technique for species identification using a short, standardized DNA. An effective DNA barcoding marker would be very helpful for unraveling the poorly understood species diversity of dinoflagellates in the natural environment. In this study, the potential utility for DNA barcoding of mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob) was assessed. Among several primer sets examined, the one amplifying a 385-bp cob fragment was most effective for dinoflagellates. This short cob fragment is easy to sequence and yet possess reasonable taxon resolution. While the lack of a uniform gap between interspecific and intraspecific distances poses difficulties in establishing a phylum-wide species-discriminating distance threshold, the variability of cob allows recognition of species within particular lineages. The potential of this cob fragment as a dinoflagellate species marker was further tested by applying it to an analysis of the dinoflagellate assemblages in Long Island Sound (LIS) and Mirror Lake in Connecticut. In LIS, a highly diverse assemblage of dinoflagellates was detected. Some taxa can be identified to the species and some to the genus level, including a taxon distinctly related to the bipolar species Polarella glacialis, and the large number of others cannot be clearly identified, due to the inadequate database. In Mirror Lake, a Ceratium species and an unresolved taxon were detected, exhibiting a temporal transition from one to the other. We demonstrate that this 385-bp cob fragment is promising for lineage-wise dinoflagellate species identification, given an adequate database.

Porphyra (Bangiophyceae) Transcriptomes Provide Insights Into Red Algal Development And Metabolism

The red seaweed Porphyra (Bangiophyceae) and related Bangiales have global economic importance. Here, we report the analysis of a comprehensive transcriptome comprising ca. 4.7 million expressed sequence tag (EST) reads from P. umbilicalis (L.) J. Agardh and P. purpurea (Roth) C. Agardh (ca. 980 Mbp of data generated using 454 FLX pyrosequencing). These ESTs were isolated from the haploid gametophyte (blades from both species) and diploid conchocelis stage (from P. purpurea). In a bioinformatic analysis, only 20% of the contigs were found to encode proteins of known biological function. Comparative analysis of predicted protein functions in mesophilic (including Porphyra) and extremophilic red algae suggest that the former has more putative functions related to signaling, membrane transport processes, and establishment of protein complexes. These enhanced functions may reflect general mesophilic adaptations. A near‐complete repertoire of genes encoding histones and ribosomal proteins was identified, with some differentially regulated between the blade and conchocelis stage in P. purpurea. This finding may reflect specific regulatory processes associated with these distinct phases of the life history. Fatty acid desaturation patterns, in combination with gene expression profiles, demonstrate differences from seed plants with respect to the transport of fatty acid/lipid among subcellular compartments and the molecular machinery of lipid assembly. We also recovered a near‐complete gene repertoire for enzymes involved in the formation of sterols and carotenoids, including candidate genes for the biosynthesis of lutein. Our findings provide key insights into the evolution, development, and biology of Porphyra, an important lineage of red algae.

Analysis of Porphyra Membrane Transporters Demonstrates Gene Transfer among Photosynthetic Eukaryotes and Numerous Sodium-Coupled Transport Systems

Membrane transporters play a central role in many cellular processes that rely on the movement of ions and organic molecules between the environment and the cell, and between cellular compartments. Transporters have been well characterized in plants and green algae, but little is known about transporters or their evolutionary histories in the red algae. Here we examined 482 expressed sequence tag contigs that encode putative membrane transporters in the economically important red seaweed Porphyra (Bangiophyceae, Rhodophyta). These contigs are part of a comprehensive transcriptome dataset from Porphyra umbilicalis and Porphyra purpurea. Using phylogenomics, we identified 30 trees that support the expected monophyly of red and green algae/plants (i.e. the Plantae hypothesis) and 19 expressed sequence tag contigs that show evidence of endosymbiotic/horizontal gene transfer involving stramenopiles. The majority (77%) of analyzed contigs encode transporters with unresolved phylogenies, demonstrating the difficulty in resolving the evolutionary history of genes. We observed molecular features of many sodium-coupled transport systems in marine algae, and the potential for coregulation of Porphyra transporter genes that are associated with fatty acid biosynthesis and intracellular lipid trafficking. Although both the tissue-specific and subcellular locations of the encoded proteins require further investigation, our study provides red algal gene candidates associated with transport functions and novel insights into the biology and evolution of these transporters.

Insights into the red algae and eukaryotic evolution from the genome of Porphyra umbilicalis (Bangiophyceae, Rhodophyta)

Significance Fossil evidence shows that red algae (Rhodophyta) are one of the most ancient multicellular lineages. Their ecological, evolutionary, and commercial importance notwithstanding, few red algal nuclear genomes have been sequenced. Our analyses of the Porphyra umbilicalis genome provide insights into how this macrophyte thrives in the stressful intertidal zone and into the basis for its nutritional value as human food. Many of the novel traits (e.g., cytoskeletal organization, calcium signaling pathways) we find encoded in the Porphyra genome are extended to other red algal genomes, and our unexpected findings offer a potential explanation for why the red algae are constrained to small stature relative to other multicellular lineages. Porphyra umbilicalis (laver) belongs to an ancient group of red algae (Bangiophyceae), is harvested for human food, and thrives in the harsh conditions of the upper intertidal zone. Here we present the 87.7-Mbp haploid Porphyra genome (65.8% G + C content, 13,125 gene loci) and elucidate traits that inform our understanding of the biology of red algae as one of the few multicellular eukaryotic lineages. Novel features of the Porphyra genome shared by other red algae relate to the cytoskeleton, calcium signaling, the cell cycle, and stress-tolerance mechanisms including photoprotection. Cytoskeletal motor proteins in Porphyra are restricted to a small set of kinesins that appear to be the only universal cytoskeletal motors within the red algae. Dynein motors are absent, and most red algae, including Porphyra, lack myosin. This surprisingly minimal cytoskeleton offers a potential explanation for why red algal cells and multicellular structures are more limited in size than in most multicellular lineages. Additional discoveries further relating to the stress tolerance of bangiophytes include ancestral enzymes for sulfation of the hydrophilic galactan-rich cell wall, evidence for mannan synthesis that originated before the divergence of green and red algae, and a high capacity for nutrient uptake. Our analyses provide a comprehensive understanding of the red algae, which are both commercially important and have played a major role in the evolution of other algal groups through secondary endosymbioses.

MAJOR DEVELOPMENTAL REGULATORS AND THEIR EXPRESSION IN TWO CLOSELY RELATED SPECIES OF PORPHYRA (RHODOPHYTA)(1).

Little is known about the genetic and biochemical mechanisms that underlie red algal development, for example, why the group failed to evolve complex parenchyma and tissue differentiation. Here we examined expressed sequence tag (EST) data from two closely related species, Porphyra umbilicalis (L.) J. Agardh and P. purpurea (Roth) C. Agardh, for conserved developmental regulators known from model eukaryotes, and their expression levels in several developmental stages. Genes for most major developmental families were present, including MADS‐box and homeodomain (HD) proteins, SNF2 chromatin‐remodelers, and proteins involved in sRNA biogenesis. Some of these genes displayed altered expression correlating with different life history stages or cell types. Notably, two ESTs encoding HD proteins showed eightfold higher expression in the P. purpurea sporophyte (conchocelis) than in the gametophyte (blade), whereas two MADS domain‐containing paralogs showed significantly different patterns of expression in the conchocelis and blade respectively. These developmental gene families do not appear to have undergone the kinds of dramatic expansions in copy number found in multicellular land plants and animals, which are important for regulating developmental processes in those groups. Analyses of small RNAs did not validate the presence of miRNAs, but homologs of Argonaute were present. In general, it appears that red algae began with a similar molecular toolkit for directing development as did other multicellular eukaryotes, but probably evolved altered roles for many key proteins, as well as novel mechanisms yet to be discovered.

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp. Using a primer derived from Eut-SL, we constructed four cDNA libraries under contrasting physiological conditions for 454 pyrosequencing. Clustering analysis of the ∼1.9×106 original reads (average length 382 bp) yielded 36,643 unique transcripts. Although only 28% of the transcripts matched documented genes, this fraction represents a functionally very diverse gene set, suggesting that SL trans-splicing is likely ubiquitous in this alga’s transcriptome. The mRNAs of Eutreptiella sp. seemed to have short 5′- untranslated regions, estimated to be 21 nucleotides on average. Among the diverse biochemical pathways represented in the transcriptome we obtained, carbonic anhydrase and genes known to function in the C4 pathway and heterotrophic carbon fixation were found, posing a question whether Eutreptiella sp. employs multifaceted strategies to acquire and fix carbon efficiently. This first large-scale transcriptomic dataset for a euglenoid uncovers many potential novel genes and overall offers a valuable genetic resource for research on euglenoid algae.

In situ diet of the copepod Calanus sinicus in coastal waters of the South Yellow Sea and the Bohai Sea

Copepods are a key trophic link between primary producers and predatory animals at higher trophic levels in the marine ecosystem. Knowledge of the in situ composition of the copepod diet is critical for the accurate evaluation of trophic relationships and energy transfer in marine food webs. In this study, we applied a PCR-based cloning technique developed previously to investigate the in situ diet of Calanus sinicus, an ecologically important largesized calanoid copepod that dominates in the shelf waters around China, Japan and Korea. Analyses of the 18S rDNA sequences obtained from the copepod diet revealed the diverse food composition of C. sinicus from two stations (Y19 in the South Yellow Sea and B49 in the Bohai Sea). A total of 43 operational taxonomic units (OTUs) were detected, which belonged to 13 diverse lineages: Bacillariophyta, Dinoflagellata, Dictyochophyceae, Chrysophyta, Katablepharidophyta, Pelagophyceae, Apusozoa, Hydrozoa, Ctenophora, Echinodermata, Tunicata, Chaetognatha and marine fungi. The results indicate that during an algae bloom, C. sinicus can graze on the bloom causative species. When the abundance of phytoplankton in ambient water is relatively low, C. sinicus can choose eggs, larvae, or organic particles/detritus of various metazoans, especially hydrozoans and ctenophores, as alternative food sources. Our result suggests that C. sinicus is an omnivorous species, and its prey choice may depend on the food availability in the ambient waters.

Spliced leader RNA trans-splicing discovered in copepods

Copepods are one of the most abundant metazoans in the marine ecosystem, constituting a critical link in aquatic food webs and contributing significantly to the global carbon budget, yet molecular mechanisms of their gene expression are not well understood. Here we report the detection of spliced leader (SL) trans-splicing in calanoid copepods. We have examined nine species of wild-caught copepods from Jiaozhou Bay, China that represent the major families of the calanoids. All these species contained a common 46-nt SL (CopepodSL). We further determined the size of CopepodSL precursor RNA (slRNA; 108-158 nt) through genomic analysis and 3′-RACE technique, which was confirmed by RNA blot analysis. Structure modeling showed that the copepod slRNA folded into typical slRNA secondary structures. Using a CopepodSL-based primer set, we selectively enriched and sequenced copepod full-length cDNAs, which led to the characterization of copepod transcripts and the cataloging of the complete set of 79 eukaryotic cytoplasmic ribosomal proteins (cRPs) for a single copepod species. We uncovered the SL trans-splicing in copepod natural populations, and demonstrated that CopepodSL was a sensitive and specific tool for copepod transcriptomic studies at both the individual and population levels and that it would be useful for metatranscriptomic analysis of copepods.