Zhiwei Song

IRES-mediated Tricistronic vectors for enhancing generation of high monoclonal antibody expressing CHO cell lines.

A Tricistronic vector utilizing internal ribosome entry site (IRES) elements to express the light chain (LC), heavy chain (HC), and a neomycin phosphotransferase (NPT) selection marker from one transcript is designed for generation of mAb expressing CHO cell lines. As compared to the commonly used vectors, benefits of this design include: (1) minimized non-expressing clones, (2) enhanced stable mAb productivity without gene amplification, (3) control of LC and HC expression at defined ratios, and (4) consistent product quality. After optimization of the LC and HC arrangement and increasing selection stringency by weakening the NPT selection marker, this Tricistronic vector is able to generate stably transfected pools with specific productivity (qmAb) greater than 5pg/cell/day (pcd) and titers over 150mg/L. 5% of clones from these pools have qmAb greater than 20pcd and titers ranging from 300 to more than 500mg/L under non-optimized shake flask batch cultures using commercially available protein-free medium. The mAb produced by these clones have low aggregation and consistent glycosylation profiles. The entire process of transfection to high-expressing clones requires only 6 months. The IRES-mediated Tricistronic vector provides an attractive alternative to commonly used vectors for fast generation of mAb CHO cell lines with high productivity.

Some commonly used caspase substrates and inhibitors lack the specificity required to monitor individual caspase activity.

Many designated substrates and inhibitors have been widely used to investigate the roles of caspases in apoptotic death during mammalian cell culture. However, the specificities of these substrates and inhibitors have not been systematically evaluated. As a result, conclusions on the roles of specific caspases in apoptotic cells have been published inaccurately. In this study, the interaction between seven commercially available human caspases and their designated substrates and inhibitors was studied. Ac-YVAD-pNA, the designated substrate for caspase-1, is found to be the most specific substrate. All other substrates tested demonstrate cross-reactivity with several caspases. In relation to the enzyme, Caspase-2 is the most specific caspase, followed by caspase-9 and -6. Caspase-3 and -7 cleave three substrates efficiently. The designated substrates for capsase-1 and -8 are not even their best substrates. Fluoromethylketone (fmk) inhibitors exhibit no specificity towards different caspases even at low concentrations. In contrast, aldehyde inhibitor potency shows a distinct relationship to pNA substrate cleavage. These results show that some commonly used caspase substrates and inhibitors lack the specificity required to monitor individual caspase activity.

The sweet tooth of biopharmaceuticals: Importance of recombinant protein glycosylation analysis

Biopharmaceuticals currently represent the fastest growing sector of the pharmaceutical industry, mainly driven by a rapid expansion in the manufacture of recombinant protein‐based drugs. Glycosylation is the most prominent post‐translational modification occurring on these protein drugs. It constitutes one of the critical quality attributes that requires thorough analysis for optimal efficacy and safety. This review examines the functional importance of glycosylation of recombinant protein drugs, illustrated using three examples of protein biopharmaceuticals: IgG antibodies, erythropoietin and glucocerebrosidase. Current analytical methods are reviewed as solutions for qualitative and quantitative measurements of glycosylation to monitor quality target product profiles of recombinant glycoprotein drugs. Finally, we propose a framework for designing the quality target product profile of recombinant glycoproteins and planning workflow for glycosylation analysis with the selection of available analytical methods and tools.

An upstream activation sequence controls the expression of AOX1 gene in Pichia pastoris

Alcohol oxidase I gene (AOX1) promoter (P(AOX1)) is a key promoter in the methylotrophic yeast Pichia pastoris. To identify the cis-acting element in the AOX1 promoter, we constructed expression plasmids in which the green fluorescent protein (GFP) gene coding region was fused to a series of internal deletion mutants of the AOX1 promoter. By analyzing the expression and transcription level of GFP by each plasmid, we identified a positive cis-element, Region D, which is located between positions -638 and -510 of the AOX1 promoter. This region contains an invert repeat-like sequence GTGGGGTCAAATAGTTTCATGTTCCCCAA that is similar to the upstream activation sequence 1 (UAS1) of alcohol dehydrogenase II gene (ADH2) in Saccharomyces cerevisiae. The inverted repeat sequence in the UAS1 is known to contain the binding site for alcohol dehydrogenase II synthesis regulator (Adr1p). When three tandem copies of Region D were inserted into the Region D-deleted AOX1 promoter, the expression of GFP at the protein level and the mRNA level increased to 157% and 135% of the wild type, respectively. An electrophoretic mobility shift assay indicated that Region D could form a DNA-protein complex with cell extracts under methanol-induced and glucose/methanol-repressed conditions. These data suggest that Region D may function as a cis-acting regulatory element in the AOX1 promoter to positively regulate the expression of AOX1.

Control of IgG LC:HC ratio in stably transfected CHO cells and study of the impact on expression, aggregation, glycosylation and conformational stability.

Immunoglobulin G (IgG), the most common class of commercial monoclonal antibodies (mAbs), exists as multimers of two identical light chains (LC) and two identical heavy chains (HC) assembled together by disulfide bridges. Due to the kinetics of mAb assembly, it is suggested that expression of LC and HC in equal amounts is not optimal for IgG production. We designed a set of vectors using internal ribosome entry site (IRES) elements to control LC and HC expression. The intracellular LC:HC ratio of stable IgG expressing Chinese hamster ovary (CHO) cell pools can be controlled effectively at four different ratios of 3.43, 1.24, 1.12, and 0.32. The stable pools were used to study the impact of LC:HC ratio on mAb expression and quality. Gene amplification was most effective for pools with excess LC and generated the highest mAb titers among the transfected pools. When LC:HC ratio was greater than one, more than 97% of the secreted products were IgG monomers. The products also have similar N-glycosylation profiles and conformational stabilities at those ratios. For pools presented a lower LC:HC ratio of 0.32, monomers only constituted half of the product with the other half being aggregates and mAb fragments. High mannose-type N-glycans increased while fucosylated and galactosylated glycans decreased significantly at the lowest LC:HC ratio. Product stability was also adversely affected. The results obtained provide insights to the impact of different LC:HC ratios on stable mAb production and useful information for vector design during generation of mAb producing cell lines.

CHO Glycosylation Mutants as Potential Host Cells to Produce Therapeutic Proteins with Enhanced Efficacy

CHO glycosylation mutants, pioneered by Stanley and co-workers, have proven to be valuable tools in glycobiology and biopharmaceutical research. Here we aim to provide a summary of our efforts to isolate industrially applicable CHO glycosylation mutants, termed CHO-gmt cells, using cytotoxic lectins and zinc-finger nuclease technology. The genetic defects in the glycosylation machinery in these cells lead to the production of recombinant glycoproteins with consistent and unique glycan structures. In addition, these mutant cells can be easily adapted to serum-free medium in suspension cultures, the condition used by the biotech industry for large-scale production of recombinant therapeutics. In light of the critical impact of glycosylation on biopharmaceutical performances, namely, safety and efficacy, the CHO-gmt lines have enormous potential in producing glycoprotein therapeutics with optimal glycosylation profiles, thus, representing a panel of ideal host cell lines for producing recombinant biopharmaceuticals with improved safety profiles and enhanced efficacy.

The Golgi CMP-sialic acid transporter: A new CHO mutant provides functional insights

A CHO mutant line, MAR-11, was isolated using a cytotoxic lectin, Maackia amurensis agglutinin (MAA). This mutant has decreased levels of cell surface sialic acid relative to both wild-type CHO-K1 and Lec2 mutant CHO cells. The CMP-sialic acid transporter (CMP-SAT) gene in the MAR-11 mutant cell has a C-T mutation that results in a premature stop codon. As a result, MAR-11 cells express a truncated version of CMP-SAT which contains only 100 amino acids rather than the normal CMP-SAT which contains 336 amino acids. Biochemical analyses indicate that recombinant interferon-gamma (IFN-gamma) produced by the mutant cells lack sialic acid. Using MAR-11 as host cells, an EPO/IEF assay for the structure-function study of CMP-SAT was developed. This assay seems more sensitive than previous assays that were used to analyze sialylation in Lec2 cells. Cotransfection of constructs that express CMP-SAT into MAR-11 cells completely converted the recombinant EPO to a sialylation pattern that is similar to the EPO produced by the wild-type CHO cells. Using this assay, we showed that CMP-SAT lacking C-terminal 18 amino acids from the cytosolic tail was able to allow high levels of EPO sialylation. Substitution of the Gly residues with Ile in three different transmembrane domains of CMP-SAT resulted in dramatic decreases in transporters activity. The CMP-SAT only lost partial activity if the same Gly residues were substituted with Ala, suggesting that the lack of side chain in Gly residues in the transmembrane domains is essential for transport activity.

Comparison of Internal Ribosome Entry Site (IRES) and Furin-2A (F2A) for Monoclonal Antibody Expression Level and Quality in CHO Cells

Four versions of tricistronic vectors expressing IgG1 light chain (LC), IgG1 heavy chain (HC), and dihydrofolate reductase (DHFR) in one transcript were designed to compare internal ribosome entry site (IRES) and furin-2A (F2A) for their influence on monoclonal antibody (mAb) expression level and quality in CHO DG44 cells. LC and HC genes are arranged as either the first or the second cistron. When using mAb quantification methods based on the detection antibodies against HC Fc region, F2A-mediated tricistronic vectors appeared to express mAb at higher levels than the IRES-mediated tricistronic vectors in both transient and stable transfections. Further analysis revealed that more than 40% of products detected in stably transfected pools generated using the two F2A-mediated tricistronic vectors were aggregates. LC and HC from the F2A stably transfected pools were not properly processed, giving rise to LC+F2A+HC or HC+F2A+LC fusion proteins, LC and HC polypeptides with F2A remnants, and incorrectly cleaved signal peptides. Both IRES-mediated tricistronic vectors express mAb with correct sizes and signal peptide cleavage. Arrangement of LC as the first cistron in the IRES-mediated tricistronic vectors exhibits increased mAb expression level, better growth, and minimized product aggregation, while arrangement of HC as first cistron results in low expression, slower growth, and high aggregation. The results obtained will be beneficial for designing vectors that enhance mAb expression level and quality in mammalian cells.

Identification of functional elements of the GDP-fucose transporter SLC35C1 using a novel Chinese hamster ovary mutant

The GDP-fucose transporter SLC35C1 critically regulates the fucosylation of glycans. Elucidation of its structure-function relationships remains a challenge due to the lack of an appropriate mutant cell line. Here we report a novel Chinese hamster ovary (CHO) mutant, CHO-gmt5, generated by the zinc-finger nuclease technology, in which the Slc35c1 gene was knocked out from a previously reported CHO mutant that has a dysfunctional CMP-sialic acid transporter (CST) gene (Slc35a1). Consequently, CHO-gmt5 harbors double genetic defects in Slc35a1 and Slc35c1 and produces N-glycans deficient in both sialic acid and fucose. The structure-function relationships of SLC35C1 were studied using CHO-gmt5 cells. In contrast to the CST and UDP-galactose transporter, the C-terminal tail of SLC35C1 is not required for its Golgi localization but is essential for generating glycans that are recognized by a fucose-binding lectin, Aleuria aurantia lectin (AAL), suggesting an important role in the transport activity of SLC35C1. Furthermore, we found that this impact can be independently contributed by a cluster of three lysine residues and a Glu-Met (EM) sequence within the C terminus. We also showed that the conserved glycine residues at positions 180 and 277 of SLC35C1 have significant impacts on AAL binding to CHO-gmt5 cells, suggesting that these conserved glycine residues are required for the transport activity of Slc35 proteins. The absence of sialic acid and fucose on Fc N-glycan has been independently shown to enhance the antibody-dependent cellular cytotoxicity (ADCC) effect. By combining these features into one cell line, we postulate that CHO-gmt5 may represent a more advantageous cell line for the production of recombinant antibodies with enhanced ADCC effect.

RCA-I-resistant CHO mutant cells have dysfunctional GnT I and expression of normal GnT I in these mutants enhances sialylation of recombinant erythropoietin

A large number of CHO glycosylation mutants were isolated by Ricinus communis agglutinin-I (RCA-I). Complementation tests revealed that all these mutant lines possessed a dysfunctional N-acetylglucosaminyltransferase I (GnT I) gene. Sequencing analyses on the GnT I cDNAs isolated from 16 mutant lines led to the identification of nine different single base pair mutations. Some mutations result in a premature stop codon whereas others cause a single amino acid substitution in the GnT I protein. Interestingly, expression of the normal GnT I cDNA in mutant cells resulted in enhanced sialylation of N-glycans. The sialylation of recombinant erythropoietin (EPO) produced in mutant cells that were co-transfected with GnT I was enhanced compared to that of EPO produced in wild type CHO cells. The enhanced sialylation of EPO produced by JW152 cells in the presence of GnT I over CHO-K1 cells is a result of increased sialylated glycan structures with higher antennary branching. These findings represent a new strategy that may be utilized by the biotechnology industry to produce highly sialylated therapeutic glycoproteins.