Network


Latest external collaboration on country level. Dive into details by clicking on the dots.

Hotspot


Dive into the research topics where Abdelhalim Trabelsi is active.

Publication


Featured researches published by Abdelhalim Trabelsi.


Infection, Genetics and Evolution | 2013

Sequence and phylogenetic analyses of human rotavirus strains: comparison of VP7 and VP8(∗) antigenic epitopes between Tunisian and vaccine strains before national rotavirus vaccine introduction.

Mouna Ben Hadj Fredj; Meriam BenHamida-Rebaï; Elisabeth Heylen; Mark Zeller; Amal Moussa; Saoussen Kacem; Marc Van Ranst; Jelle Matthijnssens; Abdelhalim Trabelsi

Group A rotaviruses (RVA) are the leading cause of severe gastroenteritis in infants and young children worldwide. Due to their epidemiological complexity, it is important to compare the genetic characteristics of vaccine strains with the RVA strains circulating before the introduction of the vaccine in the Tunisian immunization program. In the present study, the nucleotide sequences of VP7 and VP8∗ (n=31), the main targets for neutralizing antibodies, were determined. Comparison of antigenic epitopes of 11 G1P[8], 12 G2P[4], 4 G3P[8], 2 G4P[8], 1 G6P[9] and 1 G12P[8] RVA strains circulating in Tunisia from 2006 to 2011 with the RVA strains present in licensed vaccines showed that multiple amino acid differences existed in or near putative neutralizing domains of VP7 and VP8∗. The Tunisian G3 RVA strains were found to possess a potential extra N-linked glycosylation site. The Tunisian G4 RVA were closely related to the G4 vaccine strain in RotaTeq, belonging to the same lineage, but the alignment of their VP7 amino acids revealed an insertion of an asparagine residue at position 76 which is close to a glycosylation site (aa 69-71). Despite several differences detected between Tunisian and vaccine strains, which may affect binding of neutralizing antibodies, both vaccines are known to protect against the vast majority of the circulating genotypes, providing an indication of the high vaccine efficiency that can be expected in a future rotavirus immunization program.


Emerging Infectious Diseases | 2013

Feline Origin of Rotavirus Strain, Tunisia, 2008

Mouna Ben Hadj Fredj; Elisabeth Heylen; Mark Zeller; Imene Fodha; Meriam BenHamida-Rebaï; Marc Van Ranst; Jelle Matthijnssens; Abdelhalim Trabelsi

In Tunisia in 2008, an unusual G6P[9] rotavirus, RVA/human-wt/TUN/17237/2008/G6P[9], rarely found in humans, was detected in a child. To determine the origin of this strain, we conducted phylogenetic analyses and found a unique genotype constellation resembling rotaviruses belonging to the feline BA222-like genotype constellation. The strain probably resulted from direct cat-to-human transmission.


Journal of Acquired Immune Deficiency Syndromes | 2008

Monitoring of HIV-1 resistance in Tunisia (North Africa) with a dried plasma spot strategy.

Raoudha Dachraoui; Agnès Depatureaux; Mohamed Chakroun; Imene Fodha; Amel Letaief; Abdelhalim Trabelsi; Frangois Simon; I. Jean-Christophe Plantier

To the Editor: The HIV-1 epidemic is particularly severe in the resource-limited countries, where more than 30 million people are living with HIV infection. The expansion of access to antiretroviral drugs has made it necessary to develop appropriate tools for the therapeutic follow-up of patients in these regions. Epidemiologic surveillance of the spread and transmission of HIV resistant to antiretroviral drugs is also a major issue for the future use of these drugs in the resource-limited countries. Resistance genotyping has proved useful for such monitoring in the more developed countries. This method requires a sequencer, however, and its routine use outside a few reference centers is therefore difficult in resourcelimited countries. It also poses logistic problems in terms of the transport and storage of plasma samples. Many studies have demonstrated the utility of dried sample spot technology as an alternative method for serologic and molecular analyses of HIV infection. We recently demonstrated the feasibility of using a dried plasma spot/dried serum spot (DPS/DSS) method for resistance genotyping, which could be a useful alternative in clinical and epidemiologic settings. In this study, we tested a sequencing-based strategy for monitoring from a distance, in which plasma samples were collected far from the center with the sequencer and the expertise to interpret the results. Blood samples were taken from patients positive for HIV-1 in Tunisia. Plasma samples were deposited on filter paper, allowed to dry, and sent by post to our laboratory in France for analysis of resistance to antiretroviral drugs. We obtained 33 plasma samples from 24 HIV-1–infected Tunisian patients with a plasma viral load (VL) ranging from 1300 copies/mL (3.1 log) to more than 750,000 copies/mL (5.9 log) (Table 1). Samples were collected from patients who had never received highly active antiretroviral treatment (HAART) (n = 13) and from treated patients (n = 5). Serial plasma samples were collected during treatment (patient [P] 5, P15, P18, and P22) or before and during treatment (P6 and P8). VL was measured in native samples (stored at 80(C) with an Amplicor HIV-1 Monitor (version 1.5; Roche Diagnostics, Meylan, France) before spotting. A total of 20 mL of each plasma sample was spotted onto the centers of 6 circles drawn on S&S903 filter paper (Schleicher & Schuell, BioScience/Whatman, GmbH, Dassel, Germany). Filters were left to dry for 1 hour at room temperature, placed individually in small plastic bags with a sachet of desiccant, stored, and mailed to France at room temperature. A period of 9 days elapsed between sample collection and the arrival of the sample at the laboratory in Rouen. On arrival, the DPS samples were transferred to a 80(C freezer, in which they were stored until testing. RNA was extracted from a DPS, as previously described. In the absence of amplification, the extraction was repeated with another spot but with a supplementary 10-fold concentration step, using a Microcon YM-50 device (Millipore, Saint-Quentin en Yvelines, France); briefly, 100 mL of RNA eluate was deposited into the Microcon YM-50 device, centrifuged for 2 minutes at 14,000g to obtain a concentrate of 10 mL, and recovered by centrifugation for 3 minutes at 1000g turning the Microcon YM-50 device, as recommended by the manufacturer. A nested reverse transcriptase (RT) polymerase chain reaction (PCR) assay was used to amplify the protease and RT regions of the pol gene, as previously described, yielding fragments of 507 and 798 base pairs (bp), respectively. A 655bp fragment of the gp41 region encompassing the enfuvirtide (T20) target was also amplified, as follows: RNA (10 mL) was amplified in a 50-mL reaction mixture containing 2 mM of MgSO4, 20 pmol of each outer primer (1S TGGAG GAGGAGATATGAGG and AS1 GTG AGTATCCCTGCCTAACTCTAT), and 1 mL of RT/platinum Taq. Amplification reactions were carried out in a PerkinElmer (Courtaboeuf, France) 2400 thermocycler as follows: 1 cycle at 50(C for 30 minutes and 94(C for 2 minutes; followed by 35 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 68(C for 60 seconds; and a final extension step at 72(C for 7 minutes. A nested PCR assay was performed, as previously described for the RT and protease fragments, and using 20 pmol of gp41 inner primers (T20S1 GAG GGACAATTGGAGAAGTGAATT and 2AS CTACCAAGCCTCCTACTATC) with amplification conditions as follows: heating at 95(C for 15 minutes; 30 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 72(C for 30 seconds; and a final extension step at 72(C for 7 minutes Amplification products were visualized by electrophoresis in a 1% agarose gel, with ethidium bromide staining. Resistance genotyping and genetic subtyping were carried out by sequencing and phylogenetic analysis, as previously described. The resistance mutations were interpreted with the Agence Nationale de Recherches sur le Sida et les Hépatites Virales (ANRS) algorithm (July 2006 version; available at: http://www. hivfrenchresistance.org/). The results obtained are presented in Table 1. The RT-PCR techniques used to amplify the protease, RT, and gp41 regions were validated on native reference plasma samples as controls. The protease region of the 33 native plasma samples could be amplified with the protocol used, whatever the VL. The RT and gp41 regions of 3 patients (P31 for RT and P21 and P27 for gp41) could not be amplified from the native reference plasma sample, and from the corresponding DPS sample. Difficulties were encountered in amplification of the gp41 region of samples from P8: no amplification was obtained with 2 of the 3 samples available. These difficulties with the amplification of gp41 in 3 patients (P8, P21, and P27) suggest that the PCR was less robust for this fragment. The protease and RT regions were successfully amplified from all DPS samples with a VL


Journal of Pediatric Surgery | 2009

Rotavirus infection and intussusception in Tunisian children: implications for use of attenuated rotavirus vaccines.

Anissa Chouikha; Imene Fodha; Kaies Maazoun; Mohamed Ben Brahim; Saida Hidouri; Abdellattif Nouri; Abdelhalim Trabelsi; Andrew Duncan Steele

5 log (21 of 21 samples), and the gp41 region was successfully amplified in 19 of 20 cases (1 native plasma sample was not amplified with our protocol; see Table 1). The


Infection, Genetics and Evolution | 2012

Molecular characterization of the NSP4 gene of human group A rotavirus strains circulating in Tunisia from 2006 to 2008

Mouna Ben Hadj Fredj; Mark Zeller; Imene Fodha; Elisabeth Heylen; Anissa Chouikha; Marc Van Ranst; Jelle Matthijnssens; Abdelhalim Trabelsi

BACKGROUND A licensed rotavirus vaccine was withdrawn from use because of an increased risk of intussusception. The association of rotavirus vaccination with intussusception raised concerns about a potential link between natural rotavirus disease and intussusception. The objectives of the present study were to determine whether an epidemiological association with natural rotavirus infection existed. METHODS From 1984 to 2003, all children younger than 5 years with intussusception were retrospectively identified by medical charts, and from 1995 to 2003, a prospective surveillance study of rotavirus infection in children younger than 5 years was independently conducted. Epidemiological characteristics of intussusception and rotavirus infection were then compared. RESULTS A total of 533 cases of intussusception and 146 cases of rotavirus infection were identified. The incidence of intussusception for infants younger than 1 year was 62/100,000 child-years. The age distributions of intussusception and rotavirus gastroenteritis overlapped, and a masculine predominance was noted in both cases. No significant association was observed between the monthly distribution of intussusception and rotavirus infection. CONCLUSION The present study has not convincingly shown that rotavirus diarrhea plays a major role in intussusception. However, data about age and sex distributions supported the biologic plausibility of such an association.


The Journal of Infectious Diseases | 2010

Rotavirus Strain Diversity in the Centre Coast of Tunisia from 2000 through 2003

Abdelhalim Trabelsi; Imene Fodha; Anissa Chouikha; Mouna Ben Hadj Fredj; Maha Mastouri; Ahmed Ben Abdelaziz; Tahar Sfar; Ahmed Sahloul Essoussi; Samir Jaoua; A. Duncan Steele

Non-structural protein 4 (NSP4), encoded by group A rotavirus (RVA) genome segment 10, is a multifunctional protein and the first recognized virus-encoded enterotoxin. Recently, a new classification system for RVAs was proposed and a total of 14 NSP4 genotypes (E1-E14) are currently described. The most common NSP4 genotypes in humans are Wa-like E1 and DS-1-like E2. This report represents the first investigation on the genetic diversity of RVA NSP4 genes in Tunisia from 2006 to 2008. In the present study, the NSP4-encoding genes of human RVA strains with different G/P-genotype combinations were analyzed. NSP4 genes of 261 RVA-positive fecal samples were analyzed using a semi-nested reverse transcriptase-polymerase chain reaction and in addition the NSP4 gene of 46 representative RVA strains were sequenced. Phylogenetic analysis of the Tunisian NSP4 nucleotide sequences revealed the presence of two NSP4 genotypes. Genotype E1 was found to be associated with G1P[8], G3P[6], G3P[8], G4P[6] and G4P[8], whereas genotype E2 was associated with G2P[4], G2P[6] and G6P[9] samples. These results support the hypothesis that P[8] carrying RVA strains usually possess the E1 genotype, whereas P[4] carrying RVA strains usually possess the E2 genotype. P[6] carrying strains were found with both E1 and E2. The unusual G6P[9] strains possessed a E2 genotype with a possible animal origin. These results underline the need for further investigations to assess the validity of NSP4 as a suitable target for epidemiologic surveillance of RVA infections and vaccine development.


Journal of Medical Microbiology | 2016

Distribution of rotavirus VP7 and VP4 genotypes circulating in Tunisia from 2009 to 2014: Emergence of the genotype G12.

Amal Moussa; Mouna Ben Hadj Fredj; Imene Fodha; Meriam BenHamida-Rebaï; Saoussen Kacem; Aida Argoubi; Haifa Bennour; Noureddine Boujaafar; Abdelhalim Trabelsi

An epidemiological survey investigating rotavirus infection in children was undertaken in the coastal region of Tunisia from January 2000 through September 2003. A total of 309 fecal specimens were screened by enzyme-linked immunosorbent assay and latex agglutination assay for the presence of group A rotavirus antigen. The detection rate was 26.2%. Rotavirus outbreaks showed a temperature-dependant pattern (P = .026) but no significant association with rainfall. Rotavirus strains isolated were analyzed by RNA polyacrylamide gel electrophoresis and were characterized antigenically by monoclonal antibodies to the VP6 subgroup. Eight RNA electropherotypes were identified, with 3 long and 5 short different RNA profiles. Among VP6 typeable strains, all isolates with a long electrophoretic pattern carried the subgroup II specificity, whereas those with a short profile belonged to subgroup I. In total, 48 rotavirus-positive samples were analyzed for G and P typing by reverse-transcription polymerase chain reaction. A total of 8 different G and P combinations were found: G1P[8] (35.7%), G1P[6] (21.4%), G2P[4] (4.8%), G3P[4] (4.8%), G4P[6] (4.8%), G8P[8] (4.8%), G3P[8] (2.3%), and G4P[8] (2.3%). Mixed infections were detected in 19.1% of stool samples. The emergence in Tunisia of unconventional types, such as G8VP7 specificity, highlights the need for a continual survey of the uncommon strains in North Africa.


The Journal of Infectious Diseases | 2009

Emergence and Characterization of Human Rotavirus G9 Strains in Tunisia

Anissa Chouikha; Imene Fodha; Lamjed Bouslama; Mouna Ben Hadj Fredj; Samir Jaoua; Noureddine Boujaafar; Abdelhalim Trabelsi; Andrew D. Steele

Group A rotavirus (RVA) represents the most important aetiological agent of diarrhoea in children worldwide. From January 2009 to December 2014, a multi-centre study realized through 11 Tunisian cities was undertaken among children aged <5 years consulting or hospitalized for acute gastroenteritis. A total of 1127 faecal samples were collected. All samples were screened by ELISA for the presence of RVA antigen. RVA-positive samples were further analyzed by PAGE and used for G/P-genotyping by semi-nested multiplex RT-PCR. Globally, 270 specimens (24 %) were RVA-positive, with peaks observed annually between November and March. Nine different electropherotypes could be visualized by PAGE, six with a long profile (173 cases) and two with a short one (seven cases). Mixed profiles were detected in two cases. Among the 267 VP7 genotyped strains, the predominant G- genotype was G1 (39.6 %) followed by G3 (22.2 %), G4 (13 %), G9 (11.5 %), G2 (5.2 %) and G12 (5.2 %). Among the 260 VP4 genotyped strains, P[8] genotype was the predominant (74.5 %) followed by P[6] (10.4 %) and P[4] (5.5 %). A total of 257 strains (95.2 %) could be successfully G- and P-genotyped. G1P[8] was the most prevalent combination (34.4 %), followed by G3P[8] (16.3 %), G9P[8] (10.3 %), G4P[8] (8.9 %), G2P[4] (4 %), G12P[6] (2.6 %) and G12P[8] (1.9 %). Uncommon G/Pgenotype combinations, mixed infections and untypeable strains were also detected. This is the first report, in Tunisia, of multiple detection of an emerging human RVA strain, G12 genotype. This study highlighted the need for maintaining active surveillance of emerging strains in Northern Africa.Group A rotavirus (RVA) represents the most important aetiological agent of diarrhoea in children worldwide. From January 2009 to December 2014, a multi-centre study realized through 11 Tunisian cities was undertaken among children aged <5 years consulting or hospitalized for acute gastroenteritis. A total of 1127 faecal samples were collected. All samples were screened by ELISA for the presence of RVA antigen. RVA-positive samples were further analyzed by PAGE and used for G/P-genotyping by semi-nested multiplex RT-PCR. Globally, 270 specimens (24 %) were RVA-positive, with peaks observed annually between November and March. Nine different electropherotypes could be visualized by PAGE, six with a long profile (173 cases) and two with a short one (seven cases). Mixed profiles were detected in two cases. Among the 267 VP7 genotyped strains, the predominant G- genotype was G1 (39.6 %) followed by G3 (22.2 %), G4 (13 %), G9 (11.5 %), G2 (5.2 %) and G12 (5.2 %). Among the 260 VP4 genotyped strains, P[8] genotype was the predominant (74.5 %) followed by P[6] (10.4 %) and P[4] (5.5 %). A total of 257 strains (95.2 %) could be successfully G- and P-genotyped. G1P[8] was the most prevalent combination (34.4 %), followed by G3P[8] (16.3 %), G9P[8] (10.3 %), G4P[8] (8.9 %), G2P[4] (4 %), G12P[6] (2.6 %) and G12P[8] (1.9 %). Uncommon G/Pgenotype combinations, mixed infections and untypeable strains were also detected. This is the first report, in Tunisia, of multiple detection of an emerging human RVA strain, G12 genotype. This study highlighted the need for maintaining active surveillance of emerging strains in Northern Africa.


Pathologie Biologie | 2014

Sequence and structural analyses of NSP4 proteins from human group A rotavirus strains detected in Tunisia

M. Ben Hadj Fredj; M. Ben Hamida-Rebaï; Mark Zeller; Elisabeth Heylen; M. Van Ranst; Jelle Matthijnssens; Abdelhalim Trabelsi

Among human rotaviruses, G9 has emerged as the fifth most important genotype circulating globally. Ongoing surveillance of rotavirus in Tunisia during the past 10 years identified the first G9 strains in 2004. These strains exhibited the P[8] VP4 genotype and had a long RNA electrophoretype. The G9 strains were characterized by phylogenetic analysis of the VP7 gene sequence and showed high identity with other human rotavirus G9 strains belonging to the rotavirus VP7 lineage group III.


Journal of Medical Microbiology | 2017

Phylogenetic analysis of partial VP7 gene of the emerging human group A rotavirus G12 strains circulating in Tunisia.

Amal Moussa; Mouna Ben Hadj Fredj; Meriam BenHamida-Rebaï; Imene Fodha; Noureddine Boujaafar; Abdelhalim Trabelsi

BACKGROUND The NSP4 protein of group A rotavirus (RVA) has been recognized as a viral enterotoxin and plays important roles in viral pathogenesis and morphogenesis. Domains involved in structural and functional interactions have been proposed mainly based on the simian SA11 strain. METHODS NSP4 has been classified into 15 different genotypes (E1-E15), and the aim of this study was to analyze the sequences of 46 RVA strains in order to determine the aminoacid (aa) differences between E1 and E2 genotypes. Another aspect was to characterize the structural and physicochemical properties of these strains. RESULTS Comparison of deduced aa sequences of the NSP4 protein showed that divergences between NSP4 genotypes E1 and E2 were mostly observed in the VP4-binding, the interspecies variable domain (ISVD) and the double-layered particle (DLP) binding domains. Interestingly, uncommon variations in residues 131 and 138, which are known to be important aa in pathogenesis, were found in one unusual animal derived strain belonging to the E2 genotype. Concerning the structural aspect, no significant differences were noted. CONCLUSION The presence of punctual aa variations in the NSP4 genotypes may indicate that NSP4 mutates mainly via accumulation of point mutations.

Collaboration


Dive into the Abdelhalim Trabelsi's collaboration.

Top Co-Authors

Avatar

Imene Fodha

University of Monastir

View shared research outputs
Top Co-Authors

Avatar
Top Co-Authors

Avatar
Top Co-Authors

Avatar
Top Co-Authors

Avatar

Elisabeth Heylen

Rega Institute for Medical Research

View shared research outputs
Top Co-Authors

Avatar

Jelle Matthijnssens

Rega Institute for Medical Research

View shared research outputs
Top Co-Authors

Avatar

Mark Zeller

Rega Institute for Medical Research

View shared research outputs
Top Co-Authors

Avatar
Top Co-Authors

Avatar

Amal Moussa

University of Monastir

View shared research outputs
Top Co-Authors

Avatar

Marc Van Ranst

Rega Institute for Medical Research

View shared research outputs
Researchain Logo
Decentralizing Knowledge