Imene Fodha

Feline Origin of Rotavirus Strain, Tunisia, 2008

In Tunisia in 2008, an unusual G6P[9] rotavirus, RVA/human-wt/TUN/17237/2008/G6P[9], rarely found in humans, was detected in a child. To determine the origin of this strain, we conducted phylogenetic analyses and found a unique genotype constellation resembling rotaviruses belonging to the feline BA222-like genotype constellation. The strain probably resulted from direct cat-to-human transmission.

Monitoring of HIV-1 resistance in Tunisia (North Africa) with a dried plasma spot strategy.

To the Editor: The HIV-1 epidemic is particularly severe in the resource-limited countries, where more than 30 million people are living with HIV infection. The expansion of access to antiretroviral drugs has made it necessary to develop appropriate tools for the therapeutic follow-up of patients in these regions. Epidemiologic surveillance of the spread and transmission of HIV resistant to antiretroviral drugs is also a major issue for the future use of these drugs in the resource-limited countries. Resistance genotyping has proved useful for such monitoring in the more developed countries. This method requires a sequencer, however, and its routine use outside a few reference centers is therefore difficult in resourcelimited countries. It also poses logistic problems in terms of the transport and storage of plasma samples. Many studies have demonstrated the utility of dried sample spot technology as an alternative method for serologic and molecular analyses of HIV infection. We recently demonstrated the feasibility of using a dried plasma spot/dried serum spot (DPS/DSS) method for resistance genotyping, which could be a useful alternative in clinical and epidemiologic settings. In this study, we tested a sequencing-based strategy for monitoring from a distance, in which plasma samples were collected far from the center with the sequencer and the expertise to interpret the results. Blood samples were taken from patients positive for HIV-1 in Tunisia. Plasma samples were deposited on filter paper, allowed to dry, and sent by post to our laboratory in France for analysis of resistance to antiretroviral drugs. We obtained 33 plasma samples from 24 HIV-1–infected Tunisian patients with a plasma viral load (VL) ranging from 1300 copies/mL (3.1 log) to more than 750,000 copies/mL (5.9 log) (Table 1). Samples were collected from patients who had never received highly active antiretroviral treatment (HAART) (n = 13) and from treated patients (n = 5). Serial plasma samples were collected during treatment (patient [P] 5, P15, P18, and P22) or before and during treatment (P6 and P8). VL was measured in native samples (stored at 80(C) with an Amplicor HIV-1 Monitor (version 1.5; Roche Diagnostics, Meylan, France) before spotting. A total of 20 mL of each plasma sample was spotted onto the centers of 6 circles drawn on S&S903 filter paper (Schleicher & Schuell, BioScience/Whatman, GmbH, Dassel, Germany). Filters were left to dry for 1 hour at room temperature, placed individually in small plastic bags with a sachet of desiccant, stored, and mailed to France at room temperature. A period of 9 days elapsed between sample collection and the arrival of the sample at the laboratory in Rouen. On arrival, the DPS samples were transferred to a 80(C freezer, in which they were stored until testing. RNA was extracted from a DPS, as previously described. In the absence of amplification, the extraction was repeated with another spot but with a supplementary 10-fold concentration step, using a Microcon YM-50 device (Millipore, Saint-Quentin en Yvelines, France); briefly, 100 mL of RNA eluate was deposited into the Microcon YM-50 device, centrifuged for 2 minutes at 14,000g to obtain a concentrate of 10 mL, and recovered by centrifugation for 3 minutes at 1000g turning the Microcon YM-50 device, as recommended by the manufacturer. A nested reverse transcriptase (RT) polymerase chain reaction (PCR) assay was used to amplify the protease and RT regions of the pol gene, as previously described, yielding fragments of 507 and 798 base pairs (bp), respectively. A 655bp fragment of the gp41 region encompassing the enfuvirtide (T20) target was also amplified, as follows: RNA (10 mL) was amplified in a 50-mL reaction mixture containing 2 mM of MgSO4, 20 pmol of each outer primer (1S TGGAG GAGGAGATATGAGG and AS1 GTG AGTATCCCTGCCTAACTCTAT), and 1 mL of RT/platinum Taq. Amplification reactions were carried out in a PerkinElmer (Courtaboeuf, France) 2400 thermocycler as follows: 1 cycle at 50(C for 30 minutes and 94(C for 2 minutes; followed by 35 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 68(C for 60 seconds; and a final extension step at 72(C for 7 minutes. A nested PCR assay was performed, as previously described for the RT and protease fragments, and using 20 pmol of gp41 inner primers (T20S1 GAG GGACAATTGGAGAAGTGAATT and 2AS CTACCAAGCCTCCTACTATC) with amplification conditions as follows: heating at 95(C for 15 minutes; 30 cycles of 94(C for 30 seconds, 55(C for 30 seconds, and 72(C for 30 seconds; and a final extension step at 72(C for 7 minutes Amplification products were visualized by electrophoresis in a 1% agarose gel, with ethidium bromide staining. Resistance genotyping and genetic subtyping were carried out by sequencing and phylogenetic analysis, as previously described. The resistance mutations were interpreted with the Agence Nationale de Recherches sur le Sida et les Hépatites Virales (ANRS) algorithm (July 2006 version; available at: http://www. hivfrenchresistance.org/). The results obtained are presented in Table 1. The RT-PCR techniques used to amplify the protease, RT, and gp41 regions were validated on native reference plasma samples as controls. The protease region of the 33 native plasma samples could be amplified with the protocol used, whatever the VL. The RT and gp41 regions of 3 patients (P31 for RT and P21 and P27 for gp41) could not be amplified from the native reference plasma sample, and from the corresponding DPS sample. Difficulties were encountered in amplification of the gp41 region of samples from P8: no amplification was obtained with 2 of the 3 samples available. These difficulties with the amplification of gp41 in 3 patients (P8, P21, and P27) suggest that the PCR was less robust for this fragment. The protease and RT regions were successfully amplified from all DPS samples with a VL

Rotavirus infection and intussusception in Tunisian children: implications for use of attenuated rotavirus vaccines.

5 log (21 of 21 samples), and the gp41 region was successfully amplified in 19 of 20 cases (1 native plasma sample was not amplified with our protocol; see Table 1). The

Molecular characterization of the NSP4 gene of human group A rotavirus strains circulating in Tunisia from 2006 to 2008

BACKGROUND A licensed rotavirus vaccine was withdrawn from use because of an increased risk of intussusception. The association of rotavirus vaccination with intussusception raised concerns about a potential link between natural rotavirus disease and intussusception. The objectives of the present study were to determine whether an epidemiological association with natural rotavirus infection existed. METHODS From 1984 to 2003, all children younger than 5 years with intussusception were retrospectively identified by medical charts, and from 1995 to 2003, a prospective surveillance study of rotavirus infection in children younger than 5 years was independently conducted. Epidemiological characteristics of intussusception and rotavirus infection were then compared. RESULTS A total of 533 cases of intussusception and 146 cases of rotavirus infection were identified. The incidence of intussusception for infants younger than 1 year was 62/100,000 child-years. The age distributions of intussusception and rotavirus gastroenteritis overlapped, and a masculine predominance was noted in both cases. No significant association was observed between the monthly distribution of intussusception and rotavirus infection. CONCLUSION The present study has not convincingly shown that rotavirus diarrhea plays a major role in intussusception. However, data about age and sex distributions supported the biologic plausibility of such an association.

Rotavirus Strain Diversity in the Centre Coast of Tunisia from 2000 through 2003

Non-structural protein 4 (NSP4), encoded by group A rotavirus (RVA) genome segment 10, is a multifunctional protein and the first recognized virus-encoded enterotoxin. Recently, a new classification system for RVAs was proposed and a total of 14 NSP4 genotypes (E1-E14) are currently described. The most common NSP4 genotypes in humans are Wa-like E1 and DS-1-like E2. This report represents the first investigation on the genetic diversity of RVA NSP4 genes in Tunisia from 2006 to 2008. In the present study, the NSP4-encoding genes of human RVA strains with different G/P-genotype combinations were analyzed. NSP4 genes of 261 RVA-positive fecal samples were analyzed using a semi-nested reverse transcriptase-polymerase chain reaction and in addition the NSP4 gene of 46 representative RVA strains were sequenced. Phylogenetic analysis of the Tunisian NSP4 nucleotide sequences revealed the presence of two NSP4 genotypes. Genotype E1 was found to be associated with G1P[8], G3P[6], G3P[8], G4P[6] and G4P[8], whereas genotype E2 was associated with G2P[4], G2P[6] and G6P[9] samples. These results support the hypothesis that P[8] carrying RVA strains usually possess the E1 genotype, whereas P[4] carrying RVA strains usually possess the E2 genotype. P[6] carrying strains were found with both E1 and E2. The unusual G6P[9] strains possessed a E2 genotype with a possible animal origin. These results underline the need for further investigations to assess the validity of NSP4 as a suitable target for epidemiologic surveillance of RVA infections and vaccine development.

Distribution of rotavirus VP7 and VP4 genotypes circulating in Tunisia from 2009 to 2014: Emergence of the genotype G12.

An epidemiological survey investigating rotavirus infection in children was undertaken in the coastal region of Tunisia from January 2000 through September 2003. A total of 309 fecal specimens were screened by enzyme-linked immunosorbent assay and latex agglutination assay for the presence of group A rotavirus antigen. The detection rate was 26.2%. Rotavirus outbreaks showed a temperature-dependant pattern (P = .026) but no significant association with rainfall. Rotavirus strains isolated were analyzed by RNA polyacrylamide gel electrophoresis and were characterized antigenically by monoclonal antibodies to the VP6 subgroup. Eight RNA electropherotypes were identified, with 3 long and 5 short different RNA profiles. Among VP6 typeable strains, all isolates with a long electrophoretic pattern carried the subgroup II specificity, whereas those with a short profile belonged to subgroup I. In total, 48 rotavirus-positive samples were analyzed for G and P typing by reverse-transcription polymerase chain reaction. A total of 8 different G and P combinations were found: G1P[8] (35.7%), G1P[6] (21.4%), G2P[4] (4.8%), G3P[4] (4.8%), G4P[6] (4.8%), G8P[8] (4.8%), G3P[8] (2.3%), and G4P[8] (2.3%). Mixed infections were detected in 19.1% of stool samples. The emergence in Tunisia of unconventional types, such as G8VP7 specificity, highlights the need for a continual survey of the uncommon strains in North Africa.

Relationship between electropherotypes and VP7/VP4 genotypes of group A rotaviruses detected between 2000 and 2007 in Tunisian children.

Group A rotavirus (RVA) represents the most important aetiological agent of diarrhoea in children worldwide. From January 2009 to December 2014, a multi-centre study realized through 11 Tunisian cities was undertaken among children aged <5 years consulting or hospitalized for acute gastroenteritis. A total of 1127 faecal samples were collected. All samples were screened by ELISA for the presence of RVA antigen. RVA-positive samples were further analyzed by PAGE and used for G/P-genotyping by semi-nested multiplex RT-PCR. Globally, 270 specimens (24 %) were RVA-positive, with peaks observed annually between November and March. Nine different electropherotypes could be visualized by PAGE, six with a long profile (173 cases) and two with a short one (seven cases). Mixed profiles were detected in two cases. Among the 267 VP7 genotyped strains, the predominant G- genotype was G1 (39.6 %) followed by G3 (22.2 %), G4 (13 %), G9 (11.5 %), G2 (5.2 %) and G12 (5.2 %). Among the 260 VP4 genotyped strains, P[8] genotype was the predominant (74.5 %) followed by P[6] (10.4 %) and P[4] (5.5 %). A total of 257 strains (95.2 %) could be successfully G- and P-genotyped. G1P[8] was the most prevalent combination (34.4 %), followed by G3P[8] (16.3 %), G9P[8] (10.3 %), G4P[8] (8.9 %), G2P[4] (4 %), G12P[6] (2.6 %) and G12P[8] (1.9 %). Uncommon G/Pgenotype combinations, mixed infections and untypeable strains were also detected. This is the first report, in Tunisia, of multiple detection of an emerging human RVA strain, G12 genotype. This study highlighted the need for maintaining active surveillance of emerging strains in Northern Africa.Group A rotavirus (RVA) represents the most important aetiological agent of diarrhoea in children worldwide. From January 2009 to December 2014, a multi-centre study realized through 11 Tunisian cities was undertaken among children aged <5 years consulting or hospitalized for acute gastroenteritis. A total of 1127 faecal samples were collected. All samples were screened by ELISA for the presence of RVA antigen. RVA-positive samples were further analyzed by PAGE and used for G/P-genotyping by semi-nested multiplex RT-PCR. Globally, 270 specimens (24 %) were RVA-positive, with peaks observed annually between November and March. Nine different electropherotypes could be visualized by PAGE, six with a long profile (173 cases) and two with a short one (seven cases). Mixed profiles were detected in two cases. Among the 267 VP7 genotyped strains, the predominant G- genotype was G1 (39.6 %) followed by G3 (22.2 %), G4 (13 %), G9 (11.5 %), G2 (5.2 %) and G12 (5.2 %). Among the 260 VP4 genotyped strains, P[8] genotype was the predominant (74.5 %) followed by P[6] (10.4 %) and P[4] (5.5 %). A total of 257 strains (95.2 %) could be successfully G- and P-genotyped. G1P[8] was the most prevalent combination (34.4 %), followed by G3P[8] (16.3 %), G9P[8] (10.3 %), G4P[8] (8.9 %), G2P[4] (4 %), G12P[6] (2.6 %) and G12P[8] (1.9 %). Uncommon G/Pgenotype combinations, mixed infections and untypeable strains were also detected. This is the first report, in Tunisia, of multiple detection of an emerging human RVA strain, G12 genotype. This study highlighted the need for maintaining active surveillance of emerging strains in Northern Africa.

Emergence and Characterization of Human Rotavirus G9 Strains in Tunisia

BACKGROUND Rotaviruses are the most frequent agents associated with diarrhoea in children worldwide. Analysis of mobility of the 11 segments of genomic RNA by polyacrylamide gel electrophoresis (PAGE) yields a pattern which is characteristic for a particular rotavirus isolate. The group A rotaviruses can be further characterized by analysis of VP7 and VP4 genes specificities, responsible for rotavirus classification into G and P genotypes, respectively. The aim of the present study was to detect a relationship between electropherotype pattern and molecular characteristics of the rotavirus strains. MATERIAL AND METHODS Were analyzed 278 rotavirus-positive specimens by PAGE and G/P-genotyped by multiplex semi-nested RT-PCR. Pearsons correlation tests were used for statistical analysis. RESULTS Twelve different electropherotypes were visualized, eight with a long profile (186 cases) and four with a short one (87 cases). Concerning VP7 types, G2 viral strains were found to be predominant and were detected in 91 specimens (32.7%). Strains with G1, G3, G4, G8 and G9 specificities were detected in 62 (22.3%), 82 (29.5%), 13 (4.7%), two (0.7%) and seven cases (2.5%), respectively. The results of VP4 genotyping showed a predominance of P[8] genotype which comprised half of the strains identified (139 cases, 50%). VP4 P[4], P[6] and P[11] were found in 83 (29.9%), 31 (11.1%) and 11 (4.0%) specimens, respectively. A high rate of mixed strains was also found (1.8% mixed electropherotypes, 7.6% G-mixed and 5% P-mixed strains). Electropherotype pattern of rotavirus strains was significantly correlated with VP7 genotype (p=0.018) and with VP4 genotype specificities (p<0.001).

Phylogenetic analysis of partial VP7 gene of the emerging human group A rotavirus G12 strains circulating in Tunisia.

Among human rotaviruses, G9 has emerged as the fifth most important genotype circulating globally. Ongoing surveillance of rotavirus in Tunisia during the past 10 years identified the first G9 strains in 2004. These strains exhibited the P[8] VP4 genotype and had a long RNA electrophoretype. The G9 strains were characterized by phylogenetic analysis of the VP7 gene sequence and showed high identity with other human rotavirus G9 strains belonging to the rotavirus VP7 lineage group III.

271 Distribution of NSP4 Genotypes of Group A Rotavirus Strains Circulating in Tunisian Children from 2006 to 2008

Purpose. Group A rotavirus (RVA) is the leading cause of severe gastroenteritis in children younger than 5 years. The most common human G‐types are G1‐4 and G9. G12 genotype is currently emerging worldwide, becoming the sixth most prevalent RVA G‐genotype. In Tunisia, an emergence of G12 RVA strains was observed. To understand the evolution and origin of these Tunisian G12 strains, phylogenetic analyses were conducted. Methodology. A total of 1127 faecal samples were collected from Tunisian children under 5 years consulting for gastroenteritis between 2009 and 2014. Samples were screened by ELISA for the presence of RVA antigen. RVA‐positive samples were used for the detection of G12 RVA strains by semi‐nested RT‐PCR. G12‐positive specimens were subjected to VP4 genotyping reaction. PCR products of the G12‐positive samples were sequenced and characterized by phylogenetic analysis of partial VP7 gene sequence. Results. Globally, 270 (24 %) stool specimens were RVA‐positive. Fourteen presented the G12 genotype (5.2 %) and were found to be in combination with either the P[6] (50.0 %) or the P[8] (50.0 %) genotype. Phylogenetic analysis revealed that all characterized Tunisian G12 strains clustered in the modern G12 lineage III and appear to form three different subclusters. Conclusion. Thus, the Tunisian G12 strains may have originated from not a single, but at least three distinct ancestral G12 strains. Detailed molecular characterization of the entire genome of these strains remains essential to help determine the extent of genetic variation and the relatedness of Tunisian G12 RVA strains to G12 strains described worldwide.