Amy L. Kenter

KU80 IS REQUIRED FOR IMMUNOGLOBULIN ISOTYPE SWITCHING

Isotype switching is the DNA recombination mechanism by which antibody genes diversify immunoglobulin effector functions. In contrast to V(D)J recombination, which is mediated by RAG1, RAG2 and DNA double‐stranded break (DSB) repair proteins, little is known about the mechanism of switching. We have investigated the role of DNA DSB repair in switch recombination in mice that are unable to repair DSBs due to a deficiency in Ku80 (Ku80−/−). B‐cell development is arrested at the pro‐B cell stage in Ku80−/− mice because of abnormalities in V(D)J recombination, and there are no mature B cells. To reconstitute the B‐cell compartment in Ku80−/− mice, pre‐rearranged VB1−8 DJH2 (μi) and V3−83JK2 (κi) genes were introduced into the Ku80−/− background (Ku80−/−μi/+κi/+). Ku80−/−μi/+ κi/+ mice develop mature mIgM+ B cells that respond normally to lipopolysaccharide (LPS) or LPS plus interleukin‐4 (IL‐4) by producing specific germline Ig constant region transcripts and by forming switch region‐specific DSBs. However, Ku80−/−μi/+κi/+ B cells are unable to produce immunoglobulins of secondary isotypes, and fail to complete switch recombination. Thus, Ku80 is essential for switch recombination in vivo, suggesting a significant overlap between the molecular machinery that mediates DNA DSB repair, V(D)J recombination and isotype switching.

AID-dependent histone acetylation is detected in immunoglobulin S regions

Class switch recombination (CSR) is regulated by the expression of activation-induced deaminase (AID) and germline transcripts (GLTs). AID-dependent double-strand breaks (DSBs) are introduced into switch (S) regions and stimulate CSR. Although histone acetylation (Ac) has been well documented in transcription regulation, its role in DNA damage repair remains largely unexplored. The 1B4.B6 B cell line and normal splenic B cells were activated to undergo CSR and analyzed for histone Ac by chromatin immunoprecipitation (ChIP). A detailed study of the Iγ3-Sγ3-Cγ3 locus demonstrated that acetylated histones are focused to the Iγ3 exon and the Sγ3 region but not to the intergenic areas. Histone H3 Ac is strongly correlated with GLT expression at four S regions, whereas H4 Ac was better associated with B cell activation and AID expression. To more directly examine the relationship between H4 Ac and AID, LPS-activated AID KO and WT B cells were analyzed and express comparable levels of GLTs. In AID-deficient B cells, both histones H3 and H4 are reduced where H4 is more severely affected as compared with WT cells. Our findings raise the intriguing possibility that histone H4 Ac at S regions is a marker for chromatin modifications associated with DSB repair during CSR.

Class-switch recombination: after the dawn of AID

Isotype class switching is central to the humoral immune response. The discovery that mutations in the activation-induced deaminase (AID) gene inhibit class-switch recombination, somatic hypermutation and gene conversion is a major step forward in defining the underlying mechanisms of these gene modification events. The propensity of mutations to occur at dC/dG nucleotides during somatic hypermutation and the homology between AID and cytidine deaminase has resulted in studies demonstrating that AID has the properties of a cytidine-specific mutator and also that elements of the base-excision repair pathway play a central role in class switching and hypermutation. AID is not a promiscuous mutator in the B cell, suggesting that there are specific molecular targeting mechanisms that regulate the accessibility of DNA to AID and differentially regulate class-switch recombination and somatic hypermutation. During class switching, isotype-specific targeting occurs independently of AID and provides another level of specificity to this recombination event.

Two New Isotype-Specific Switching Activities Detected for Ig Class Switching

Ig class switch recombination (CSR) occurs by an intrachromosomal deletional process between switch (S) regions in B cells. To facilitate the study of CSR, we derived a new B cell line, 1.B4.B6, which is uniquely capable of μ→γ3, μ→ε, and μ→α, but not μ→γ1 CSR at its endogenous loci. The 1.B4.B6 cell line was used in combination with plasmid-based isotype-specific S substrates in transient transfection assays to test for the presence of trans-acting switching activities. The 1.B4.B6 cell line supports μ→γ3, but not μ→γ1 recombination, on S substrates. In contrast, normal splenic B cells activated with LPS and IL-4 are capable of plasmid-based μ→γ1 CSR and demonstrate that this S plasmid is active. Activation-induced deaminase (AID) was used as a marker to identify existing B cell lines as possible candidates for supporting CSR. The M12 and A20 cell lines were identified as AID positive and, following activation with CD40L and other activators, were found to differentially support μ→ε and μ→α plasmid-based CSR. These studies provide evidence for two new switching activities for μ→γ1 and μ→ε CSR, which are distinct from μ→γ3 and μ→α switching activities previously described. AID is expressed in all the B cell lines capable of CSR, but cannot account for the isotype specificity defined by the S plasmid assay. These results are consistent with a model in which isotype-specific switching factors are either isotype-specific recombinases or DNA binding proteins with sequence specificity for S DNA.

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Class switch recombination: An emerging mechanism

Class switch recombination (CSR) has been the least well understood of the Ig gene DNA rearrangements. The discovery that activation-induced deaminase (AID) is a pivotal player in CSR as well as somatic hypermutation (SHM) and its variant, gene conversion, represents a sea change in our understanding of these processes. The recognition that AID directly deaminates ssDNA has provided a springboard toward the emergence of a model that explains the initiation of these events. Nonhomologous end joining (NHEJ), the main pathway for the repair of double-strand breaks in mammalian cells plays a key role in the resolution of CSR transactions. Mediators of general double-strand break repair are also involved in CSR and are mutated in several immunodeficiency diseases. A global picture of the mechanism of CSR is emerging and is providing new insights toward understanding the genetic events that underlie B cell cancers.

AID targeting is dependent on RNA polymerase II pausing

Activation induced deaminase (AID) is globally targeted to immunoglobulin loci, preferentially focused to switch (S) regions and variable (V) regions, and prone to attack hotspot motifs. Nevertheless, AID deamination is not exclusive to Ig loci and the rules regulating AID targeting remain unclear. Transcription is critically required for class switch recombination and somatic hypermutation. Here, I consider the unique features associated with S region transcription leading to RNA polymerase II pausing, that in turn promote the introduction of activating chromatin remodeling, histone modifications and recruitment of AID to targeted S regions. These findings allow for a better understanding of the interplay between transcription, AID targeting and mistargeting to Ig and non-Ig loci.

Mapping of a Functional Recombination Motif that Defines Isotype Specificity for μ→γ3 Switch Recombination Implicates NF-κB p50 as the Isotype-specific Switching Factor

Ig class switch recombination (CSR) requires expression of activation-induced deaminase (AID) and production of germline transcripts to target S regions for recombination. However, the mechanism of CSR remains unclear. Here we show that an extrachromosomal S plasmid assay is AID dependent and that a single consensus repeat is both necessary and sufficient for isotype-specific CSR. Transfected switch substrates specific for μ→γ3 and μ→γ1 are stimulated to switch with lipopolysaccharide (LPS) alone or LPS and interleukin-4, respectively. An Sγ3/Sγ1 substrate containing only three Sγ3-associated nucleotides reconstituted LPS responsiveness and permitted mapping of a functional recombination motif specific for μ→γ3 CSR. This functional recombination motif colocalized with a binding site for NF-κB p50, and p50 binding to this site was previously established. We show a p50 requirement for plasmid-based μ→γ3 CSR using p50-deficient B cells. Switch junctions from p50-deficient B cells showed decreased lengths of microhomology between Sμ and Sγ3 relative to wild-type cells, indicating a function for p50 in the mechanics of CSR. We note a striking parallel between the affects of p50 and Msh2 deficiency on Sμ/Sγ3 junctions. The data suggest that p50 may be the isotype-specific factor in μ→γ3 CSR and epistatic with Msh2.

Flexible ordering of antibody class switch and V(D)J joining during B-cell ontogeny

V(D)J joining is mediated by RAG recombinase during early B-lymphocyte development in the bone marrow (BM). Activation-induced deaminase initiates isotype switching in mature B cells of secondary lymphoid structures. Previous studies questioned the strict ontological partitioning of these processes. We show that pro-B cells undergo robust switching to a subset of immunoglobulin H (IgH) isotypes. Chromatin studies reveal that in pro-B cells, the spatial organization of the Igh locus may restrict switching to this subset of isotypes. We demonstrate that in the BM, V(D)J joining and switching are interchangeably inducible, providing an explanation for the hyper-IgE phenotype of Omenn syndrome.

THE LIAISON OF ISOTYPE CLASS SWITCH AND MISMATCH REPAIR : AN ILLEGITIMATE AFFAIR

The Ig class switch allows the expression of a V region with new CH regions associated with various effector functions (for reviews, see references ([1][1]) and ([2][2])). Switch recombination (SR) occurs by an intrachromosomal deletion process in which the intervening genetic material between the