Robert Wuerffel

KU80 IS REQUIRED FOR IMMUNOGLOBULIN ISOTYPE SWITCHING

Isotype switching is the DNA recombination mechanism by which antibody genes diversify immunoglobulin effector functions. In contrast to V(D)J recombination, which is mediated by RAG1, RAG2 and DNA double‐stranded break (DSB) repair proteins, little is known about the mechanism of switching. We have investigated the role of DNA DSB repair in switch recombination in mice that are unable to repair DSBs due to a deficiency in Ku80 (Ku80−/−). B‐cell development is arrested at the pro‐B cell stage in Ku80−/− mice because of abnormalities in V(D)J recombination, and there are no mature B cells. To reconstitute the B‐cell compartment in Ku80−/− mice, pre‐rearranged VB1−8 DJH2 (μi) and V3−83JK2 (κi) genes were introduced into the Ku80−/− background (Ku80−/−μi/+κi/+). Ku80−/−μi/+ κi/+ mice develop mature mIgM+ B cells that respond normally to lipopolysaccharide (LPS) or LPS plus interleukin‐4 (IL‐4) by producing specific germline Ig constant region transcripts and by forming switch region‐specific DSBs. However, Ku80−/−μi/+κi/+ B cells are unable to produce immunoglobulins of secondary isotypes, and fail to complete switch recombination. Thus, Ku80 is essential for switch recombination in vivo, suggesting a significant overlap between the molecular machinery that mediates DNA DSB repair, V(D)J recombination and isotype switching.

AID-dependent histone acetylation is detected in immunoglobulin S regions

Class switch recombination (CSR) is regulated by the expression of activation-induced deaminase (AID) and germline transcripts (GLTs). AID-dependent double-strand breaks (DSBs) are introduced into switch (S) regions and stimulate CSR. Although histone acetylation (Ac) has been well documented in transcription regulation, its role in DNA damage repair remains largely unexplored. The 1B4.B6 B cell line and normal splenic B cells were activated to undergo CSR and analyzed for histone Ac by chromatin immunoprecipitation (ChIP). A detailed study of the Iγ3-Sγ3-Cγ3 locus demonstrated that acetylated histones are focused to the Iγ3 exon and the Sγ3 region but not to the intergenic areas. Histone H3 Ac is strongly correlated with GLT expression at four S regions, whereas H4 Ac was better associated with B cell activation and AID expression. To more directly examine the relationship between H4 Ac and AID, LPS-activated AID KO and WT B cells were analyzed and express comparable levels of GLTs. In AID-deficient B cells, both histones H3 and H4 are reduced where H4 is more severely affected as compared with WT cells. Our findings raise the intriguing possibility that histone H4 Ac at S regions is a marker for chromatin modifications associated with DSB repair during CSR.

Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells.

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Mapping of a Functional Recombination Motif that Defines Isotype Specificity for μ→γ3 Switch Recombination Implicates NF-κB p50 as the Isotype-specific Switching Factor

Ig class switch recombination (CSR) requires expression of activation-induced deaminase (AID) and production of germline transcripts to target S regions for recombination. However, the mechanism of CSR remains unclear. Here we show that an extrachromosomal S plasmid assay is AID dependent and that a single consensus repeat is both necessary and sufficient for isotype-specific CSR. Transfected switch substrates specific for μ→γ3 and μ→γ1 are stimulated to switch with lipopolysaccharide (LPS) alone or LPS and interleukin-4, respectively. An Sγ3/Sγ1 substrate containing only three Sγ3-associated nucleotides reconstituted LPS responsiveness and permitted mapping of a functional recombination motif specific for μ→γ3 CSR. This functional recombination motif colocalized with a binding site for NF-κB p50, and p50 binding to this site was previously established. We show a p50 requirement for plasmid-based μ→γ3 CSR using p50-deficient B cells. Switch junctions from p50-deficient B cells showed decreased lengths of microhomology between Sμ and Sγ3 relative to wild-type cells, indicating a function for p50 in the mechanics of CSR. We note a striking parallel between the affects of p50 and Msh2 deficiency on Sμ/Sγ3 junctions. The data suggest that p50 may be the isotype-specific factor in μ→γ3 CSR and epistatic with Msh2.

Flexible ordering of antibody class switch and V(D)J joining during B-cell ontogeny

V(D)J joining is mediated by RAG recombinase during early B-lymphocyte development in the bone marrow (BM). Activation-induced deaminase initiates isotype switching in mature B cells of secondary lymphoid structures. Previous studies questioned the strict ontological partitioning of these processes. We show that pro-B cells undergo robust switching to a subset of immunoglobulin H (IgH) isotypes. Chromatin studies reveal that in pro-B cells, the spatial organization of the Igh locus may restrict switching to this subset of isotypes. We demonstrate that in the BM, V(D)J joining and switching are interchangeably inducible, providing an explanation for the hyper-IgE phenotype of Omenn syndrome.

NF-κB p50-Dependent In Vivo Footprints at Ig Sγ3 DNA Are Correlated with μ→γ3 Switch Recombination

NF-κB has been demonstrated to play critical roles in multiple aspects of immune responses including Ig H chain isotype switching. To better define the specific roles the p50 subunit of NF-κB plays in μ→γ3 switch recombination (SR), we systematically evaluated p50-deficient B cells for activities that are strongly correlated with SR. B cell activation with LPS plus anti-IgD-dextran plus IL-5 plus IL-4 plus TGF-β produced normal levels of proliferation and γ3 germline transcripts in p50-deficient B cells, but μ→γ3 SR was impaired. In vitro binding studies previously showed that NF-κB p50 homodimer binds the switch nuclear B-site protein (SNIP) of the Sγ3 tandem repeat. Ligation-mediated PCR in vivo footprint analysis demonstrates that the region spanning the SNIP and switch nuclear A-site protein (SNAP) binding sites of the Sγ3 region are contacted by protein in normal resting splenic B cells. B cells that are homozygous for the targeted disruption of the gene encoding p50 (−/−) show strong aberrant footprints, whereas heterozygous cells (+/−) reveal a partial effect in Sγ3 DNA. These studies provide evidence of nucleoprotein interactions at switch DNA in vivo and suggest a direct interaction of p50 with Sγ3 DNA that is strongly correlated with SR competence.

Three-dimensional architecture of the IgH locus facilitates class switch recombination.

Immunoglobulin (Ig) class switch recombination (CSR) is responsible for diversification of antibody effector function during an immune response. This region‐specific recombination event, between repetitive switch (S) DNA elements, is unique to B lymphocytes and is induced by activationinduced deaminase (AID). CSR is critically dependent on transcription of noncoding RNAs across S regions. However, mechanistic insight regarding this process has remained unclear. New studies indicate that long‐range intrachromosomal interactions among IgH transcriptional elements organize the formation of the S/S synaptosome, as a prerequisite for CSR. This three‐dimensional chromatin architecture simultaneously brings promoters and enhancers into close proximity to facilitate transcription. Here, we recount how transcription across S DNA promotes accumulation of RNA polymerase II, leading to the introduction of activating chromatin modifications and hyperaccessible chromatin that is amenable to AID activity.

Extremely Long-Range Chromatin Loops Link Topological Domains to Facilitate a Diverse Antibody Repertoire

Early B cell development is characterized by large-scale Igh locus contraction prior to V(D)J recombination to facilitate a highly diverse Ig repertoire. However, an understanding of the molecular architecture that mediates locus contraction remains unclear. We have combined high-resolution chromosome conformation capture (3C) techniques with 3D DNA FISH to identify three conserved topological subdomains. Each of these topological folds encompasses a major VH gene family that become juxtaposed in pro-B cells via megabase-scale chromatin looping. The transcription factor Pax5 organizes the subdomain that spans the VHJ558 gene family. In its absence, the J558 VH genes fail to associate with the proximal VH genes, thereby providing a plausible explanation for reduced VHJ558 gene rearrangements in Pax5-deficient pro-B cells. We propose that Igh locus contraction is the cumulative effect of several independently controlled chromatin subdomains that provide the structural infrastructure to coordinate optimal antigen receptor assembly.

NF-κB binds to the immunoglobulin Sγ3 region in vivo during class switch recombination

Ig class switch recombination (CSR) is dependent upon the expression of activation‐induced deaminase and targeted to specific isotypes by germ‐line transcript expression and isotype‐specific factors. NF‐κB plays critical roles in multiple aspects of B cell biology and has been implicated in the mechanism of CSR by in vitro binding assays and altered S/S junctions derived from NF‐κB p50‐deficient mice. However, the pleiotropic contributions of NF‐κB to gene expression in B cells has made discerning a direct role for NF‐κB in CSR difficult. We now observe that binding of NF‐κB components p50 and p65 is detected on Sγ3 in vivo following lipopolysaccharide (LPS) activation and repressed by LPS + IL–4, suggesting a direct role for this factor in CSR. In vivo footprinting confirms occupancy of a previously defined NF‐κB recognition site in Sγ3 with the same temporal kinetics as found in the chromatin immunoprecipitation analysis. Binding of NF‐κB components p50 and p65 was also detected on Sγ1 following B cell activation. H3 histone hyper acetylation at Sγ1 is strongly correlated with NF‐κB binding, suggesting that NF‐κB mediates chromatin remodeling in the Sγ3 and Sγ1 region.

Switch Region Identity Plays an Important Role in Ig Class Switch Recombination

Ig class switch recombination (CSR) is regulated through long-range intrachromosomal interactions between germline transcript promoters and enhancers to initiate transcription and create chromatin accessible to activation-induced deaminase attack. CSR occurs between switch (S) regions that flank Cμ and downstream CH regions and functions via an intrachromosomal deletional event between the donor Sμ region and a downstream S region. It is unclear to what extent S region primary sequence influences differential targeting of CSR to specific isotypes. We address this issue in this study by generating mutant mice in which the endogenous Sγ3 region was replaced with size-matched Sγ1 sequence. B cell activation conditions are established that support robust γ3 and γ1 germline transcript expression and stimulate IgG1 switching but suppress IgG3 CSR. We found that the Sγ1 replacement allele engages in μ→γ3 CSR, whereas the intact allele is repressed. We conclude that S region identity makes a significant contribution to CSR. We propose that the Sγ1 region is selectively targeted for CSR following the induction of an isotype-specific factor that targets the S region and recruits CSR machinery.