Angela Ruiz-Extremera

Follow-up of transmission of hepatitis C to babies of human immunodeficiency virus-negative women: the role of breast-feeding in transmission

Background. The studies on hepatitis C virus (HCV) vertical transmission, the effect of potential risk factors and the role of breast‐feeding have reported conflicting results. Patients and methods. Seventy‐three infants of 63 anti‐HCV‐positive and anti‐HIV‐negative mothers were studied from 1993 to 1999 in the south of Spain. The mean period of follow‐up in children was 29.2 ± 19 months (range, 8 to 76 months); 6 (8%) children were lost to follow‐up. Breast milk was studied for HCV‐RNA in 68 samples of 35 mothers. Results. Alanine aminotransferase was high in 19 (26%) and HCV‐RNA was positive in 46 (63%) pregnant woman. Breast milk HCV‐RNA was negative in nonviremic mothers and positive in 20% of the viremic mothers. The overall rate of vertical HCV transmission was 11.9% (n = 8) (95% confidence interval, 6 to 23%) if HCV‐RNA was positive one or more times, but only 1.5% (n = 1) (95% confidence interval, 0.1 to 9%) if HCV‐RNA was permanently positive. Seven HCV‐infected children did not develop antibodies to HCV, and they had a spontaneous clearance of the virus. A 10‐month‐old baby was HCV‐RNA‐positive from birth to the end of the follow‐up. The genotype in each of the infants was consistent with that of their mother. The rate of HCV transmission was higher for infants of mothers with higher HCV viremia (P < 0.01) and also for infants whose mothers were HCV‐RNA‐positive in breast milk (P < 0.05). There were no statistically significant differences between other risk factors. Conclusion. The presence of transitory viremia without seroconversion indicates that the vertical transmission of HCV is not important. This could be related to the viral charge and ingestion of milk of HCV‐RNA‐positive mothers. However, to advise avoidance of maternal breast feeding, it would be necessary to conduct larger studies.

High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

ABSTRACT Hepatitis C virus (HCV) is classified into seven major genotypes and 67 subtypes. Recent studies have shown that in HCV genotype 1-infected patients, response rates to regimens containing direct-acting antivirals (DAAs) are subtype dependent. Currently available genotyping methods have limited subtyping accuracy. We have evaluated the performance of a deep-sequencing-based HCV subtyping assay, developed for the 454/GS-Junior platform, in comparison with those of two commercial assays (Versant HCV genotype 2.0 and Abbott Real-time HCV Genotype II) and using direct NS5B sequencing as a gold standard (direct sequencing), in 114 clinical specimens previously tested by first-generation hybridization assay (82 genotype 1 and 32 with uninterpretable results). Phylogenetic analysis of deep-sequencing reads matched subtype 1 calling by population Sanger sequencing (69% 1b, 31% 1a) in 81 specimens and identified a mixed-subtype infection (1b/3a/1a) in one sample. Similarly, among the 32 previously indeterminate specimens, identical genotype and subtype results were obtained by direct and deep sequencing in all but four samples with dual infection. In contrast, both Versant HCV Genotype 2.0 and Abbott Real-time HCV Genotype II failed subtype 1 calling in 13 (16%) samples each and were unable to identify the HCV genotype and/or subtype in more than half of the non-genotype 1 samples. We concluded that deep sequencing is more efficient for HCV subtyping than currently available methods and allows qualitative identification of mixed infections and may be more helpful with respect to informing treatment strategies with new DAA-containing regimens across all HCV subtypes.

Epidemiology, serological markers, and hepatic disease of anti-HCV ELISA-2-positive blood donors

The epidemiology associated with hepatitis C virus (HCV) infection, serologic reactivity, and hepatic disease related to anti-HCV-positive donors of Granada were researched. From 1990 through 1993, medical and epidemiological information and anti-HCV and HCV RNA testing were evaluated in 46,741 blood donors. Serum samples were obtained for anti-HCV ELISA and RIBA and HCV RNA determination. A liver biopsy was conducted in all anti-HCV positives by confirmatory second-generation RIBA to analyze the hepatic lesion and the presence of HCV RNA. The anti-HCV prevalence was 1.12%. A total of 228 anti-HCV second-generation ELISA positive blood donors were analyzed. Intrafamiliar transmission rate was 1.7%. Transfusion and intravenous drug abuse (IVDA) antecedents were associated with a higher risk of seroconversion. A RIBA-positive result was related to high second- and third-generation ELISA ratios (90%), HCV RNA positivity (89%), and elevated alanine aminotransferase (ALT) levels (88%). Approximately 50% of donors with normal ALT levels had high ELISA ratios and second-generation RIBA and HCV RNA positive results. Of the second-generation RIBA indeterminate results, 42% and 82% of the c22 and 33% and 100% of the c100 reactivities were third-generation RIBA and HCV RNA positive, respectively. Liver biopsy was conducted in 85 donors, 74% of whom had a chronic hepatitis and 83% had detectable HCV RNA levels. Chronic hepatitis was diagnosed in 88% vs 43% of donors with elevated and normal alanine aminotransferase levels, respectively. ELISA and confirmatory HCV RNA determinations should be routinely employed in donor screening. A liver biopsy should be conducted in patients with elevated ALT levels and normal ALT levels when viremic.

Gender-related invasion differences associated with mRNA expression levels of melatonin membrane receptors in colorectal cancer

Melatonin inhibits growth and invasive capacity of colon cancer cells in vitro through its membrane (MT1 and MT2) and/or nuclear receptors (RORα). Previous studies showed that this indoleamine is present in both the normal and colon cancer at similar levels. Therefore, we analyzed MT1, MT2, and RORα expression in tumor samples versus normal mucosa (NM) from patients suffering from colorectal cancer (CRC). Given the existence of sex differences in the incidence and pathology of CRC and the involvement of steroid receptors in the oncostatic actions of melatonin in some types of cancer, we also analyzed the expression of androgen (AR) and estrogen receptor (ER) α and ERβ. Finally, we conducted some experiments in colon cancer cell lines to corroborate the experiments carried out in human tumors. We found a decreased expression of MT1, MT2, AR, ERα, and ERβ in tumor samples versus NM, but no changes in RORα expression in the whole cohort of patients. Classifying tumors by stage and gender, MT1, MT2, AR, ERα, and ERβ expression decreased in both early stage and advanced tumors, but only in male patients. On the other hand, MT1 and MT2 expression correlated positively with AR, ERα, and ERβ expression in male patients and with ERα or ERβ in female patients. In vitro, the invasive capacity was higher in cells with the least expression of MT1, MT2, and AR, and nonselective MT1/MT2 agonists inhibited cell growth and invasion. These results could indicate a possible interaction of these pathways.

Quasispecies as Predictive Response Factors for Antiviral Treatment in Patients with Chronic Hepatitis C

AbstractThe object of this study was to evaluate the viral factor, especially the quasispecies, as predictive of sustained virologic response. We studied the quasispecies, genotype, viral load, and hepatitis C (HCV) cAg in 41 patients with chronic hepatitis C treated with interferon and in 84 with interferon and ribavirin. In the interferon group, responders presented a lower viral load. From logistic regression analysis of patients treated with interferon plus ribavirin, independent predictors for sustained virologic response were genotype 3a, a low baseline viral load and ≤3 bands quasispecies. Genotype and viral load presented higher specificity and positive predictive value than did quasispecies. In patients with genotype 1, viral load ≤5 × 105 IU/mL and ≤3 quasispecies were predictive for sustained virologic response. In conclusion, the predictive factors of virologic response are genotype, viral load, and quasispecies. Quasispecies did not improve on the genotype or the viral load as predictors of virologic response.

Neurodevelopment of neonates in neonatal intensive care units and growth of surviving infants at age 2 years.

SUMMARY The presence of development disorders in neonates attended in a Neonatal Intensive Care Unit (NICU) is highly variable; the aim of this study, therefore, was to determine the evolution of somatic and neurosensory development in a group of neonates requiring treatment in the NICU and to analyse the perinatal and developmental aspects of children presenting abnormalities. PATIENTS AND METHODS A total of 492 neonates (275 premature, 106 with birthweight < or =1500 g), who were treated in the NICU between January 1994 and December 1997, were followed-up until the age of 2 years. Data were obtained concerning birthweight, body length, head circumference, gestational age, normality of weight for gestational age, single/multiple birth, duration of stay in the NICU and the hospital, duration of mechanically assisted respiration and evolutive somatometry, neurological examination and the Brunet-Lezine development test, adjusted for the gestational age of the neonates, at 6, 12, 18 and 24 months. When abnormal results were detected, Early Attention (EA) programmes were applied. RESULTS Somatometry at birth in relation to gestational age revealed a weekly weight gain of 8.6%, an increase in body length of 1% and in head circumference of 1% (p<0.001). The evolution of somatic development to the age of 2 years showed that neonates with a birthweight < or =1500 g did not reach the values of neonates with a greater birthweight. The prevalence of cerebral palsy among all neonates was 6.8%, 14.6% among those weighing < or =1500 g, 4% among those weighing 1501-2500 g and 5% among those weighing >2500 g. The overall rate of neurosensory injury was 10.5%. These neonates presented less somatic development than those did with no neurologic disorder. To sum up, most of the neonates attended in the NICU during the 1990s presented a normal pattern of development. Nevertheless, they should be the object of special attention during the first years of life, particularly those neonates with a birthweight < or =1500 g and those presenting neurosensory risk.

Analysis of Immunogenetic Factors in Idiosyncratic Drug-Induced Liver Injury in the Paediatric Population.

Objectives: Idiosyncratic drug-induced liver injury is a multifactorial complex disease, in which the toxic potential of the drug, together with genetic and acquired factors and deficiencies in adaptive processes, which limit the extent of damage, can determine susceptibility, and make individuals unique in their development of hepatotoxicity. The aim of the present study is to analyse the genetic factors (human leukocyte antigen [HLA], cytokine polymorphisms, and killer cell immunoglobulin-like receptor [KIR] genotype) of children who experience an episode of drug-induced liver injury. Patients and Methods: Prospective multicentre case-control study. The subjects included in the study were 30 paediatric patients—infants and children ages between 0 and 15 years and who presented possible liver disease associated with the intake of medicines, herbal products, drugs, or toxins. As a control group, 62 subjects were selected. Results: Although HLAC0401 and HLADQB0603 may provide a hepatoprotective mechanism in the paediatric population, HLADQA0102 and HLA-DR*12 are more commonly found in sick children and their presence may be related to liver damage. The KIR inhibitor KIR3DL1 was not present in any child in the control group. Conclusions: Polymorphisms that are low producers of interleukin-10 occur more frequently in children who have experienced hepatotoxicity.

Correction for Quer at al., High-Resolution Hepatitis C Virus Subtyping Using NS5B Deep Sequencing and Phylogeny, an Alternative to Current Methods

Volume 53, no. 1, p. [219–226][1], 2015. Page 221, Table 1: The sequence for primer 13N5Bo8254 should read “GTTGTAAAACGACGGCCAGT CNTAYGAYACCMGNTGYTTTGACTC .” [1]: /lookup/doi/10.1128/JCM.02093-14