Anshul Jadli

Promising prognostic markers of Preeclampsia: New avenues in waiting

Preeclampsia is a pregnancy related condition identified by hypertension and either proteinuria or end-organ dysfunction after 20(th) week of gestation and complicates 2-8% pregnancies worldwide. Enigmatic pathophysiology and multi-system involvement hinder accurate identification and clinical management of patients. Inadequate trophoblast invasion and subsequent inflammatory response have been implicated in the onset of PE. In absence of effective treatment of preeclampsia except delivery, recent research has been focused on identification of specific and sensitive biomarkers for early prediction of PE. Several angiogenic, anti-angiogenic, inflammatory, biophysical (mean arterial pressure and uterine artery Doppler) biomarkers, alone and in combination, have been proposed for prediction but limited predictive values have hindered their use in clinical settings. Current review summarizes some of relatively new biomarkers such as corin, copeptin, microparticles and miRNA, the prognostic efficiency of which are either analyzed in associated disorders or recently discovered.

Paradoxical Bleeding and Thrombosis in a Patient With Afibrinogenemia and Fibrinogen Mumbai Mutation

OBJECTIVES Thrombosis is rarely reported in cases of afibrinogenemia and is generally associated with thrombophilia or replacement therapy. Often, it is difficult to predict whether the patients will bleed or whether they are exposed to the risk of thrombosis. METHODS We report a patient with afibrinogenemia who presented with complete thrombosis of right hepatic, portal, and splenic veins and who described a lifelong history of bleeding. Direct sequencing of the three fibrinogen genes was performed to identify the mutation. RESULTS DNA sequencing showed the presence of a homozygous for G8017A substitution in exon 8 of the fibrinogen β-chain gene, resulting in a G434D missense mutation (Fibrinogen Mumbai). CONCLUSIONS Presence of both bleeding and thrombotic manifestations in a patient with afibrinogenemia in the presence of other associated risk factors warrants a very careful individualized approach in the management of patients with afibrinogenemia.

Spectrum of mutations in Indian patients with fibrinogen disorders and its application in genetic diagnosis of the affected families.

patient in this case had never previously developed a FVIII inhibitor. This presentation with spontaneous acute compartment syndrome and life-threatening bleeding due to the development of an inhibitor for the first time in an adult with congenital haemophilia A is very rare with only a few cases documented in the literature [4,9,10]. In patients with congenital haemophilia A who develop a FVIII inhibitor, treatment is with bypassing agents, either activated prothrombin complex concentrates or recombinant factor VIIa. Both products have an efficacy of approximately 80%. However, haemostasis is never guaranteed during a particular episode with a particular agent and so clinical monitoring of efficacy is essential [9]. This was demonstrated in the current case with the initial failure of rFVIIa and the need to change treatment to an activated prothrombin complex concentrate to achieve haemostasis. A multidisciplinary approach was of the utmost importance in this case. Input from the haematology, orthopaedic, anaesthetic and intensive care teams, the plastic surgeon, the physiotherapists and the psychologists was essential in the initial management and the postoperative recovery. This case highlights the importance of treating patients with haemophilia who develop significant musculoskeletal complications in comprehensive care centres where access to multidisciplinary services and appropriate clinical expertise is readily available. It also identifies the risk of non-traumatic compartment syndrome in persons with haemophilia, especially when rapid increases in muscle bulk have occurred.

Prediction of small‐for‐gestational‐age at 35–37 weeks of gestation: too late for management?

We read with great interest the recent report by Fadigas et al.1, presenting biomarker-based prediction of small-for-gestational age (SGA) at 35–37 weeks of gestation. In a prospective screening study, the authors used serum levels of placental growth factor (PlGF) and soluble fms-like tyrosine kinase-1 (sFlt-1) in a multivariable regression analysis for prediction of SGA. They reported significantly lower median PlGF multiples of the median (MoM) values and significantly higher median sFlt-1 MoM in the SGA group compared with controls. The addition of serum PlGF marginally improved the screening performance of a combined model including maternal factors and estimated fetal weight for prediction of SGA, in the absence of PE. Even though the results appear encouraging, the delay in prediction of SGA is a matter of concern. Prenatal prediction of SGA in the late third trimester of pregnancy can have little impact on management. SGA has been associated with stillbirth, intrapartum hypoxia, neurodevelopmental delay, cerebral palsy, cardiovascular complications, metabolic syndrome and diabetes later in life. Following a structured antenatal surveillance program, Lindqvist and Molin found a need for antepartum identification of SGA, with SGA fetuses not identified antenatally showing a four-fold increased risk for adverse outcome compared with those identified antenatally2. A single course of antenatal corticosteroids has been suggested for management of SGA fetuses, to accelerate fetal lung function and hence reduce neonatal mortality and morbidity3. Similarly, administration of magnesium sulphate has been recommended for prevention of cerebral palsy in neonates born before 30 weeks’ gestation4. As Fadigas et al. rightly predict, identification of biomarkers at 35–37 weeks of gestation in SGA will not facilitate effective management. Thus, there is a need for biophysical and biochemical markers, alone or in combination, for early prediction of SGA, to improve maternal and fetal surveillance and reduce fetal mortality and morbidity. One such biomarker which has shown encouraging results, with both diagnostic and prognostic importance, is microparticles. These are submicronic phospholipid vesicles, highly prothrombotic in nature, that are produced from different cell types, due either to activation or apoptosis. They have shown strong association with adverse pregnancy conditions such as recurrent fetal loss and pre-eclampsia5,6. It is thus logical to expect a similar association of elevated microparticles with SGA, presumably much earlier in pregnancy, which should facilitate effective management for improved pregnancy outcome.

Is peripheral blood corin level clinically relevant for prediction of pre‐eclampsia?

We read with great interest the recent report by Khalil et al.1, describing the potential use of maternal plasma corin and midregional proatrial natriuretic peptide for early prediction of preterm pre-eclampsia (PE). They observed significantly lower levels of maternal plasma corin until 20 weeks of gestation in the preterm PE group compared with the normotensive group and concluded that maternal plasma levels of corin can potentially be used as an early predictor of preterm PE. However, the relevance of corin in the maternal peripheral circulation for prediction of PE has been questioned in a recent landmark study by Cui et al.2, wherein the authors elucidated the role of corin in trophoblast invasion and uterine spiral artery remodeling, but found elevated levels of plasma corin in PE patients compared with controls. Using transgenic/knockout mice, these authors successfully demonstrated that cardiac-derived corin did not rescue mice from pregnancy-induced hypertension, indicating a localized function of corin in uterine tissues. Zaki et al.3 have also reported higher levels of plasma corin in PE patients than in normal pregnant women. Corin is a transmembrane cardiac protease involved in sodium homeostasis and blood pressure regulation. Corin deficiency has been linked to high blood pressure and expression of corin was detected in the decidua of pregnant uteri, indicating a role in pregnancy4. The presence of much higher levels of corin in the plasma of women with PE clearly explains that maternal plasma corin may not reflect corin levels in uterine tissues. Reduced uterine corin function leads to impaired pro-atrial natriuretic peptide processing and hence impaired uterine artery remodeling4. Plasma corin level is often obscured by cardiac corin, released in response to high blood pressure in PE patients4. Thus, it may not reflect accurately the localized functional corin levels around uterine tissues and may, in fact, have only a minor role to play in predicting PE. Even though there are conflicting results from different studies with regard to the role of plasma corin in predicting PE, it appears to have potential as a marker for early prediction of PE. Both uterine-tissue-specific and peripheral-circulation corin levels should be analyzed in large-scale studies, to assess its role as a sensitive and specific predictive biomarker for PE and other adverse pregnancy-related conditions. A. Jadli, K. Ghosh and S. Shetty* Department of Haemostasis and Thrombosis, National Institute of Immunohaematology (ICMR), Mumbai 400012, India *Correspondence. (e-mail: shrimatishetty@yahoo.com)

High heterozygosity frequency of three exonic SNPs of factor V gene (F5): implications for genetic diagnosis

Sir, Isolated coagulation factor V (FV) deficiency (parahaemphilia) is a rare autosomal recessive bleeding disorder affecting both sexes with a prevalence of about one in one million1. Patients with FV deficiency exhibit mild to severe bleeding symptoms with clinical manifestations ranging from ecchymosis, menorrhagia, epistaxis to haemarthrosis and intracranial bleeds1,2. The factor V (F5) gene is located on chromosome 1q23, spans about 80 kb and has 25 exons and 24 introns with a 7 kb mRNA which encodes a protein of 2224 amino acids. The complete F5 cDNA sequence has already been published3,4. More than 100 mutations and 700 polymorphisms have been reported in the F5 mutation database5. Among all coagulation disorders, FV deficiency is the least characterized disorder at the molecular level. Patients with FV deficiency generally exhibit a bleeding tendency of variable severity; intracranial and gastrointestinal haemorrhages, haematomas and haemarthroses are also reported in a few patients. Major phenotypic determinant in FV deficiency has been reported to be platelet FV levels6. Though the disease is rare in countries like India where consanguineous marriages are common, there is a high prevalence of autosomal recessive disorders including FV deficiency. Except one report7, there is no published study on the molecular characterization of FV deficient cases from India. Direct sequencing of the gene though accurate, is not cost-effective due to the large size of the gene and heterogeneity of mutations and is thus difficult to implement in many laboratories. Indirect method of gene tracking is an extremely simple and accurate method, when it is based on intragenic markers. However, assessing the informativeness of the marker in each population is important as there is a considerable variation in the heterozygotic frequency of these markers in different populations8,9,10. In the present study, polymorphisms in F5 were analysed in a group of healthy individuals with an objective to utilize them for genetic diagnosis in FV deficient families by direct DNA sequencing. The study was conducted at the Department of Haemostasis and Thrombosis, National Institute of Immunohaematology, Mumbai, India, including 65 unrelated healthy subjects from the Institute. After obtaining informed written consent, 10 ml blood sample was collected from each participant in EDTA and DNA was extracted from these samples using commercial kits (Invitrogen, CA, USA). PCR amplification was performed using primers designed by primers 3 and UCSC genome browser (Sigma Aldrich, India). The PCR reaction mixture consisted of 1U Taq polymerase (Bioron, Ludwigshafen, Germany), 1.5 mmol/l magnesium chloride, 1 μmol/l of the forward and reverse primers and 150 ng of DNA. The primer sequences and PCR conditions for exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms were as follows: Exon 13 (637 bp) - forward (5’-3’) TGCTGACTATGATTACCAGA, reverse (5’-3’) GAGTAACAGATCACTAGGAGG. PCR conditions: Denaturation at 94°C for 5 min followed by 35 cycles of denaturation (95°C, 40 sec), annealing (56°C, 40 sec), and extension (72°C for 40 sec) along with a final extension at 72°C for five minutes. Exon 16 (286 bp) - forward (5’-3’) GAGGCAATACAATTTACTC, reverse (5’-3’) CAGTGTGATTTAATTAGGAG. PCR conditions: Denaturation at 94°C for 5 min followed by 30 cycles of denaturation (95°C, 1 min), annealing (55°C, 2 min), extension (72°C for 1 min), followed by a final extension at 72°C for seven minutes. Amplified products were subjected to direct sequencing of the exons and the intron - exon boundaries of F5 using an ABI 3130 genetic analyzer (Applied Biosystems, USA). The study protocol was approved by the Institutional Ethics Committee. A total of 12 polymorphisms were detected, of which three showed high heterozygosity frequency in our population i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) (Table). The cumulative heterozygosity frequency of these three markers was 67.69 per cent. Table Heterozygosity frequencies of polymorphic markers of F5 During the course of the study, a family was referred from Uttar Pradesh for antenatal diagnosis in the first trimester of pregnancy. After obtaining a detailed medical and family history, blood samples of both parents and index case were collected and the chorionic villus sampling (CVS) was done at 11th weeks of pregnancy in the mother. DNA from blood samples and CVS was isolated using commercial kits (Invitrogen, USA) and subjected to gene tracking analysis by direct DNA sequencing technique using the above three markers i.e. exon 13 A2663G (K830R), A2684G (H837R) and exon 16 A5380G (M1736V) polymorphisms. The diagnosis could be successfully offered to this family using exon 13 A2663G (K830R) polymorphism. The family was non-informative for exon 13 A2684G (H837R) and exon 16 A5380G (M1736V) markers. As the mother was homozygous for this marker, the foetus is either normal or a carrier of the mutation. Thus the diagnosis of an ‘unaffected’ foetus was offered. The child was subsequently followed up after delivery and was found to be normal for factor V levels with a normal genotype. The present study shows that these three markers can successfully be used in carrier diagnosis and prenatal diagnosis in majority of the FV deficient families in India. Due to the high cost involved in direct DNA or mRNA analysis involved in mutation detection, indirect linkage analysis using such highly informative polymorphic markers may be considered as the method of choice for genetic diagnosis in developing countries.