Asma Yasmeen Khan

Investigations on the interaction of the phototoxic alkaloid coralyne with serum albumins

The interaction of the phototoxic alkaloid coralyne with bovine and human serum albumins (BSA, HSA) was investigated. Absorbance and fluorescence quenching experiments revealed the formation of strong complexes. Based on the binding parameters calculated from Stern-Volmer quenching method, coralyne has higher affinity to BSA (~10(5) M(-1)) compared to HSA (~10(4) M(-1)). Forster resonance energy transfer studies showed that the specific binding distances between Trp (donor) of the proteins and coralyne (acceptor) were 2.95 and 3.10 nm, respectively. The bindings were favored by negative enthalpy and a stronger favorable entropy contribution. The heat capacity values for binding to BSA and HSA were similar, indicating the involvement of similar molecular forces in the complexation. Competitive binding experiments using site markers demonstrated that coralyne binds to site I (subdomain IIA) of both proteins. The secondary structure of the proteins was altered, suggesting a small but definitive partial unfolding on complexation.

Phenazinium dyes safranine O and phenosafranine induce self-structure in single stranded polyadenylic acid: structural and thermodynamic studies.

The interaction of phenazinium dyes, safranine O and phenosafranine with single stranded polyadenylic acid was studied using spectroscopic viscometric and calorimetric techniques. Both dyes bind to polyadenylic acid strongly with association constant of the order of 10(5)M(-1). Safranine O showed higher affinity over phenosafranine. The binding induced conformational changes in polyadenylic acid, but the extent of change was much higher with safranine O. The bound safranine O molecules acquired strong induced circular dichroism spectra compared to the weak induced circular dichroism of phenosafranine. Fluorescence polarization, iodide quenching, viscosity results and energy transfer from bases to bound dyes suggested intercalation of the dye molecules to polyadenylic acid structure. The binding was entropy driven in both the cases. Circular dichroism and optical melting studies revealed cooperative melting profiles for dye-polyadenylic acid complexes that provided evidence for the formation of self-structured polyadenylic acid on dye binding. This structural reorganization was further confirmed by differential scanning calorimetry results.

Natural isoquinoline alkaloids: binding aspects to functional proteins, serum albumins, hemoglobin, and lysozyme

The putative anticancer alkaloids berberine, palmatine, jatrorrhizine, and sanguinarine are known to bind to nucleic acids. To develop them as potential drugs for therapeutic use, their binding affinity to functional proteins and mode of transport in the circulatory system need to be clearly understood. Towards this, many studies on their binding aspects to proteins have been reported and a considerable amount of data, mostly of biophysical nature, exists in the literature. The importance of these natural isoquinoline alkaloids and the recent literature on their interaction phenomena with functional proteins, serum albumins, hemoglobin, and lysozyme are presented in this review.

Interaction of phenazinium dyes with double-stranded poly(A): spectroscopy and isothermal titration calorimetry studies.

A comprehensive study on the binding of phenazinium dyes viz. janus green B, indoine blue, safranine O and phenosafranine with double stranded poly(A) using various spectroscopic and calorimetric techniques is presented. A higher binding of janus green B and indoine blue over safranine O and phenosafranine to poly(A) was observed from all experiments. Intercalative mode of binding of the dyes was inferred from fluorescence polarization anisotropy, iodide quenching and viscosity experiments. Circular dichroism study revealed significant perturbation of the secondary structure of poly(A) on binding of these dyes. Results from isothermal titration calorimetry experiments suggested that the binding was predominantly entropy driven with a minor contribution of enthalpy to the standard molar Gibbs energy. The results presented here may open new opportunities in the application of these dyes as RNA targeted therapeutic agents.

Spectroscopic studies on the binding interaction of phenothiazinium dyes, azure A and azure B to double stranded RNA polynucleotides

This manuscript presents spectroscopic characterization of the interaction of two phenothiazinium dyes, azure A and azure B with double stranded (ds) ribonucleic acids, poly(A).poly(U), poly(C).poly(G) and poly(I).poly(C). Absorbance and fluorescence studies revealed that these dyes bind to the RNAs with binding affinities of the order 10(6)M(-1) to poly(A).poly(U), and 10(5)M(-1) to poly(C).poly(G) and poly(I).poly(C), respectively. Fluorescence quenching and viscosity data gave conclusive evidence for the intercalation of the dyes to these RNA duplexes. Circular dichroism results suggested that the conformation of the RNAs was perturbed on interaction and the dyes acquired strong induced optical activity on binding. Azure B bound to all the three RNAs stronger than azure A and the binding affinity varied as poly(A).poly(U)>poly(C).poly(G)>poly(I).poly(C) for both dyes.

Probing the binding of anticancer drug topotecan with human hemoglobin: Structural and thermodynamic studies

Protein - ligand interactions play pivotal role in almost all the biological processes occurring in living organisms, and therefore such studies hold immense importance from the standpoint of rational drug design and development. In this study the binding of the topoisomerase I inhibitor drug, topotecan to hemoglobin was probed using various biophysical and microcalorimetry techniques. Spectrofluorimetric data confirmed the static nature of the quenching mechanism of the protein induced by the drug. Significant conformational changes in the protein were ascertained from circular dichroism and three dimensional fluorescence results. Synchronous fluorescence study revealed an increase in the polarity around the Trp residues of the protein while atomic force microscopy study enabled to obtain images of the bound molecules. Isothermal titration calorimetry studies indicated an exothermic binding with a negative Gibbs energy change; ionic strength variation suggested a greater contribution from non-polyelectrolytic forces in the binding process. Differential scanning calorimetry studies indicated an increased thermal stabilization of the protein upon topotecan binding which is also in close agreement with the results obtained from absorbance and circular dichroism melting studies. Overall this manuscript presents results on the molecular interaction from structural and energetic perspectives providing an in depth insight into drug-protein interaction.

Exploring the binding interaction of potent anticancer drug topotecan with human serum albumin: spectroscopic, calorimetric and fibrillation study

This manuscript describes the interaction of the topoisomerase I inhibitor anticancer drug topotecan with human serum albumin using microcalorimetry, circular dichroism, and atomic force microscopy imaging techniques. Conformational change in albumin was ascertained from circular dichroism and synchronous fluorescence study that revealed a small but definitive partial unfolding of the protein structure upon drug binding. Isothermal titration calorimetry study indicated a favorable exothermic interaction with a binding affinity of the order of ~105 M−1 at 293.15 K. A 1:1 binding stoichiometry was established. The binding reaction was largely enthalpy dominated with negative standard molar Gibbs energy change. Ionic strength variation study revealed that non-polyelectrolytic forces played dominant role in the interaction and remained almost invariant at all salt concentrations. Upon complex formation, the stabilization of the protein structure against thermal denaturation occurred. Atomic force microscopy study enabled imaging of fibrils of the protein and its complex with topotecan.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV–vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5′-(GGGTTAGGGTTAGGGTTAGGG)-3′ was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M−1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M−1, and that of BER was (0.98 ± 0.03) × 105 M−1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex–berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.