Azhar Mohamad

Enhancement of antioxidant enzymes activities in rice callus by ascorbic acid under salinity stress

Ascorbic acid (AsA) is naturally occurring compound with antioxidant activity and plays a pivotal role in plant cell adaptation to salinity stress. The objective of this work was to assess the influence of exogenous AsA on the embryogenic callus of indica rice (Oryza sativa L.) cv. MRQ74 cultivated under saline conditions. NaCl (200 mM) decreased callus fresh and dry masses, relative growth rate, and K+ and Ca+2 content, and increased Na+ content and Na+/K+ ratio. Application of AsA (0.5 or 1 mM) alleviated these effects of salinity. Activities of peroxidase, catalase, superoxide dismutase, as well as content of proline increased due to the NaCl treatment, and these parameters were mostly further increased by 0.5 mM AsA. Thus, AsA can increase callus tolerance to NaCl stress.

Impact of gamma rays exposure and growth regulators on Oryza sativa L. c.v MR269 callus induction

The study is aimed to evaluate in vitro somatic embryogenesis to gamma ray exposure and the use of growth regulators to mature embryos explants for rice callus induction. Seeds of local rice genotype (MR269) were exposed to gamma rays at 350 Gy (Source: Caesium-137). Matured embryos were cultured to induce callus on Murashige and Skoog (MS) supplemented at different concentrations of 1.0, 2.0, 3.0 mg/L 2.4-D and 0.1 and 0.2 mg/L Kinetin for 4 weeks. Callus induction and callus fresh weight were decreased after exposure to gamma ray. The most efficient response to callus induction and callus fresh weight was found at 3 mg/L 2,4-D and 0.1 mg/L kinetin.

Molecular identification of Aquilaria spp. by using inter-simple sequence repeat (ISSR)

Aquilaria species are very important economic plant for production of resin locally known as gaharu in Malaysia. There are five species that can be found in Malaysia and the most important Aquilaria species for gaharu production is A. malaccensis. Molecular markers for Aquilaria species are still insufficient and require more efficient, robust and reproducible molecular marker. Inter-simple sequence repeat (ISSR) markers are highly polymorphic and have high reproducibility which will be useful in areas of genetic diversity, phylogenetic studies, gene tagging, genome mapping and evolutionary biology in a wide range of crop species. Five selected ISSR primers were used to identify four Aquilaria species commonly found in Malaysia namely A. malaccensis, A. sub-integra, A. crassna and A. hirta. All the primers showed sufficient polymorphism to distinguish between the four species. Hence, the markers derived from ISSR can be used for molecular identification of Aquilaria spp. in ensuring homogenous species for...

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec−1. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD50 to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated s...

Efficient somatic embryo production of Limau madu (Citrus suhuiensis Hort. ex Tanaka) in liquid culture

Effects of N6-benzylaminopurine (BAP) concentration, initial cell density and carbon sources and concentrations for producing cell suspension and somatic embryos of Limau madu ( Citrus suhuiensis Hort. ex Tanaka) were investigated using cell suspension culture. Cells were first inoculated into Murashige and Skoog (MS) medium (1962) supplemented with 4.4 to 13.3 μM BAP. Growth rate of cells was at its maximum (6.69 mg day -1 ) in media supplemented with a lower concentration of BAP (6.7 μM). Embryogenic cell at 2 mg ml -1 was found to be the most effective inoculum size for the highest growth rate (3.35 mg day -1 ) of cell proliferation within a period of 15 to 30 days after inoculation (DAI). This inoculum size resulted in 31.75% faster embryo growth than those with inoculum densities of 4 to 6 mg ml -1 . Sucrose (88, 117 and 146 mM), glycerol (16, 22 and 27 mM) and combinations of sorbitol and galactose (146:0, 110:36, 73:73, 36:110 and 0:146 mM) were tested for their effects on embryogenic cell proliferation and somatic embryo induction. Results indicates that sucrose at 146 mM induced cell proliferation (7.65 mg day -1 ) and produced a higher quantity of cells than glycerol at 27 mM (2.33 mg day -1 ) and a combination of sorbitol and galactose at 73:73 mM (4.64 mg day-1), but failed to induce somatic embryos. Glycerol in different concentrations was ineffective in cell proliferation and somatic embryo induction. At optimal BAP concentration (6.7 μM), a small amount of embryogenic cells (100 mg in 50 ml) can be multiplied profusely in sucrose-containing medium. A large number of somatic embryos (951) were induced in a medium containing 110 mM sorbitol and 36 mM galactose as the most effective carbon source for inducing somatic embryos without BAP. Key words : Limau madu, cell suspension, sucrose, sorbitol, galactose.

Impact of exogenous ascorbic acid on biochemical activities of rice callus treated with salt stress

The application of in vitro systems can lead to new methods of crop amelioration. This method has been widely utilized for breeding tenacities, particularly for stress tolerance selection. Salinity causes oxidative stress in callus by enhancing the production of Reactive Oxygen Species (ROS), resulting in an efficient antioxidant system. The exogenous application of ascorbic acid (AsA) is an important requirement for tolerance. The present study aimed to examine in vitro selection strategy for callus induction in rice mature embryo culture on MS culture medium and to produce salt-tolerant callus under sodium chloride (NaCl) and AsA conditions in callus rice variety, MR269. This study also highlights changes in the activities of proline and antioxidants peroxidase (POD), catalase (CAT) and superoxide dismutase (SOD) of callus under NaCl stress to understand their possible role in salt tolerance. However, various levels of exogenously applied AsA under saline conditions improved callus, and the antioxidant ...

Applications of polysaccharides (β-glucan) for physiological and biochemical parameters for evaluation rice tolerance under salinity stress at seedling stage

Salt stress is considered to be the most important abiotic stress and is the main problem in the interruption of the metabolic processes of plants, thereby limiting crop production. The present study was carried out to examine the effects of exogenously applied mushroom polysaccharides (β-glucan) on the growth of two rice varieties of Oryza sativa L. (MRQ74 and MR269) seedlings grown in vitro in 200 Mm sodium chloride (NaCl). Growth characteristics, including shoot and root height, and fresh and dry weight of salt-stressed rice seedlings were inhibited by sodium chloride treatment, the degree of which depends on the rice variety. The negative effects of salinity stress resulted in an imbalance of N, K+ Na+ and Na/K ratios and biochemical analysis activities a degradation of chlorophyll content in the plants. However, treatment with exogenously applied polysaccharides (β-glucan) ameliorated the stress generated by NaCl and improved the parameters mentioned above. The significance of the changes in growth and metabolism to salt stress tolerance in rice seedlings are discussed in the paper.

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5’ TCTTGGCGAGTTCGAAGAAT 3’; BGR3: 5’ TTCCGATCTTGGTCTGGAAG 3’) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. ...