Fauzi Daud

A nationwide biotechnology outreach and awareness program for Malaysian high schools

Biotechnology education in developing nations remains one of the rate limiting factors in achieving optimal human resource capacity to drive and tap the bio-resources of these nations. Many developing countries are situated within rich bio-diversity enclaves. Biotechnology offers the promise of tapping these bio resources towards due process of developing these nations. While there may be a steady stream of biology and biotechnology based graduates, from Malaysian as well as foreign universities contributing to the human resource base for these countries, the numbers and knowledge diversity produced, still lack the capacity to optimally power research and development as well as supply the industrial biotechnology sectors of these countries. Realizing the need to address these issues at the grassroots level of higher education, Malaysia has taken an active step of bringing biotechnology into the classrooms of high schools throughout the country. These future generations of Malaysians, are hoped to progress towards manning and driving Malaysias BioValley initiatives (a biotech based R&D and industry cluster), towards the national dream of developed nation status by the year 2020, using biotechnology as an economic growth vehicle. Here, we share our experiences in developing and proliferating a biotechnology awareness program for Malaysian high schools. It is hoped that similar programs will strive towards similar objectives in other developing countries.

Preliminary study on the potential of polysaccharide from indigenous Tiger's Milk mushroom (Lignosus rhinocerus) as anti-lung cancer agent

Tigers Milk mushroom is a tropical polypore genus that can be found in the tropical part of the world in Australia, Papua New Guinea, Philippines, Indonesia, Malaysia, Sri Lanka and Vanuatu. In Malaysia, Lignosus rhinocerus is the most sought after medicinal mushroom by Semai aborigine upon request by local herbalist. This priced mushroom has been used traditionally to treat various diseases such as asthma, breast cancer, cough, fever and food poisoning. Current results indicated polysaccharide from sclerotia of indigenous L. rhinocerus extracted through hot water is able to inhibit up to 45% growth of human lung carcinoma. Inhibition is achieved when concentration of polysaccharide are in the range of 4-8 μg/ml. Present preliminary study suggests beta-glucan-rich polysaccharide from sclerotia of indigenous L. rhinocerus has anti-proliferation activity on human lung carcinoma (A549).

Radiosensitivity study and radiation effects on morphology characterization of grey oyster mushroom Pleurotus sajor-caju

Radiosensitive dosage and morphology characterization of irradiated grey oyster mushroom Pleurotus sajor-caju by gamma rays was investigated due to effects of irradiation. In order to establish the effect, mycelium of P. sajor-caju was irradiated by gamma rays at dose 0.1 to 8.0 kGy with dose rate 0.227 Gy sec−1. The irradiation of mycelia was carried out at the radiation facility in Malaysian Nuclear Agency. The radiosensitivity study was performed by evaluating the percentage of survival irradiated mycelia. The lethal dose of the mycelium P. sajor-caju was determined at 4.0 kGy and LD50 to be equal at 2.2 kGy. The radiation effects on morphology were evaluated based on growth rate of irradiated mycelia, mycelia types, colonization period on substrate, morphology of fruit bodies and yields. The results shown growth rate of irradiated mycelium was slightly lower than the control and decreased as the dose increased. Irradiation was found can induced the primordia formation on PDA and the BE of irradiated s...

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5’ TCTTGGCGAGTTCGAAGAAT 3’; BGR3: 5’ TTCCGATCTTGGTCTGGAAG 3’) was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. ...

In vitro antidiabetic activity of various crude extracts of Boletus variipes

Diabetes mellitus is a complex metabolic disease that progressively spread worldwide and difficult to treat due to various physical and metabolic complications. Current treatment using synthetic drugs has lead to various undesirable side effects. Here we determined the effect of Boletus variipes extracts on diabetes related enzymes. In this study, hot water, cold water and methanol extracts of B. variipes were utilized in order to assess their in vitro antidiabetic activity by measuring the effect on α-amylase and α-glucosidase enzyme. Hot water extract possessed the highest inhibition activity of α-amylase and α-glucosidase in a concentration dependent manner with the IC50 value 87 mg/mL and 89 mg/mL respectively. The methanol extract also showed inhibition activity of α-amylase and α-glucosidase but significantly lower than the hot water extract. Whereas cold water extract did not show any inhibition activity towards both the enzymes. Therefore, it is hypothesized that the hot water extract of Boletus v...