B.V. Bhaskara Reddy

Characterisation, genetic diversity and antagonistic potential of 2,4-diacetylphloroglucinol producing Pseudomonas fluorescens isolates in groundnut-based cropping systems of Andhra Pradesh, India

This study is focused on isolation and characterisation of 2,4-diacetylphloroglucinol (2,4-DAPG)-producing Pseudomonas fluorescens isolates from different soils of groundnut-based cropping systems in Andhra Pradesh. In our studies, 21 isolates of P. fluorescens were isolated and confirmed through various biochemical tests, of which five were tested positive for 2,4-DAPGproduction with specific primers. Biocontrol potential of these isolates on groundnut stem rot pathogen (Sclerotium rolfsii) was determined through in vitro dual culture assays. The eight isolates were found effective against S. rolfsii (up to 75% inhibition) in dual culture method. All the five 2,4-DAPG-producing Plant Growth-Promoting Rhizobacteria isolates were highly antagonistic to S. rolfsii. Genetic diversity of these P. fluorescens isolates was determined by random amplification of polymorphic DNA analysis. Overall, our results suggest that the prevalence of 2,4-DAPG-producing fluorescent Pseudomonads in different crop rhizospheres of groundnut-based cropping systems.

First report of Groundnut Bud Necrosis Virus infecting Taro (Colocasia esculenta)

The natural occurrence of Groundnut Bud Necrosis Virus (GBNV) on Colocasia esculenta was detected by enzyme linked immunosorbent assay using an antiserum raised against GBNV and reverse transcription polymerase chain reaction using coat protein specific primers. Sequence analysis showed 93–99% and 95–99% identity at nucleotide and amino acid levels respectively with other reported GBNV isolates.

First Report of Tobacco streak virus Infecting Kenaf (Hibiscus cannabinus) in India

The natural occurrence of Tobacco streak virus (TSV) in Hibiscus cannabinus was detected by enzyme-linked immunosorbent assay using an antiserum raised against TSV and reverse transcription polymerase chain reaction (PCR) using primers specific for the coat protein gene of the virus. Sequence analysis of the PCR products showed 99.6 and 99.5% of maximum identity at nucleotide and amino acid levels, respectively with TSV onion isolate from Kurnool (HM131490).This is the first report of the natural occurrence of TSV on kenaf in India.

Mungbean yellow mosaic India virus is associated with yellow mosaic disease of blackgram (Vigna mungo L.) in Andhra Pradesh, India

To study the variability and to identify the species of Begomovirus associated with yellow mosaic disease of blackgram in Andhra Pradesh, India, infected blackgram samples were collected from six districts belonging to three regions of Andhra Pradesh. The total DNA was isolated by modified CTAB method and amplified with coat protein gene-specific primers (RHA-F and AC abut) resulting in 900 bp gene product. The PCR products were cloned, sequenced and deposited in GenBank. The sequence analysis of six clones showed that the size of amplified CP gene of YMV was 920 bp. Based on nucleotide sequence identity of six isolates representing three regions of Andhra Pradesh, the isolates from Rayalaseema and Telangana region are the same variant of YMV (>99.5% identity) and isolate from coastal Andhra is another variant of YMV (>95.4%) when compared with other region isolates. Comparison of CP gene sequence of YMV-TPT isolate with 27 other isolates in database revealed more than 93.2 and 86.2% identity with MYMIV isolates and less than 80 and 64% identity with MYMY isolates that originate from Indian sub-continent and South-East Asia at nucleotide and amino acid level, respectively. Phylogenetic tree based on CP gene sequences of six isolates with other isolates from GenBank formed unique cluster with MYMIV. Hence the YMV infecting blackgram in Andhra Pradesh is caused by MYMIV rather than MYMY as reported in Tamil Nadu which is adjoining state in southern India.

FIRST REPORT OF GROUNDNUT BUD NECROSIS VIRUS IN JASMINE

Jasmine (Jasminum sambac) is a popular flower and oil-bearing plant in the family Oleaceae. India is the second producer and exporter of jasmine in the world. In April 2012, commercial jasmine fields in the Thiruvallur district of Tamil Nadu (India) showed mosaic and chlorotic spots on the young leaves. Based on symptomatology, the involvement in disease aetiology of Groundnut bud necrosis virus (GBNV, genus Tospovirus, family Bunyaviridae) was suspected. The presence of this virus in symptomatic jasmine leaves was firsrt ascertained by direct antigen coating (DAC)-ELISA (Clark and Joseph, 1984), using a polyclonal antiserum raised to GBNV and it was further confirmed by RT-PCR using primers designed in the nucleocapsid gene (Satyanarayana et al., 1996). The 830 bp amplicon was cloned in pTZ57R/T vector (Fermentas, USA) and sequenced. The nucleotide sequence was deposited in GenBank (accession No. JQ995170). Sequence analysis (BioEdit v. 7.05) showed 99.7% and 100% identity with the nucleocapsid gene of other GBNV isolates at the nucleotide and amino acid levels, respectively. Phylogenetic trees constructed using MEGA version 4.0 confirmed the close relationship of the GBNV isolate from jasmine with another isolate from groundnut (GenBank accession No. HM770020). The infected crop was removed to eradicate the infection. To the best of our knowledge, this is the first report of GBNV on jasmine.

FIRST REPORT OF TOBACCO STREAK VIRUS IN CASTOR BEAN

Castor bean (Ricinus communis L.), family Euphorbiaceae, is indigenous to the southeastern Mediterranean Basin, India and East Africa. India is the world leader in castor bean production with 2.25 million tonnes in 2011, followed by China and Brazil. In March 2013, necrotic spots and vein mosaic were observed on the lower side of the leaves in a castor bean field at the Regional Agricultural Research Station, Tirupati, India. Based on the symptomatology, infection by Tobacco streak virus (TSV, genus Ilarvirus, family Bromoviridae) was suspected. The presence of TSV in symptomatic leaves was ascertained by DAS-ELISA using TSV polyclonal antibodies. RT-PCR using total RNA isolated from leaf tissue by the Trizol method and primers specific for the coat protein gene of TSV (CP-F, 5’AGCAGATGCCCAACTTGTTT3’; CP-R, 5’AAGGGAGCTGGTTTGGATA3’) (Bhat et al., 2002) yielded a product 602 bp in size. The amplicon was cloned in pTZ57R/T vector (Fermentas, USA) and sequenced. The nucleotide sequence was deposited in GenBank as accession No. KC683810. Sequence analysis (BioEdit V7.0.5) showed more than 99% identity at the nucleotide level with 15 other TSV isolates infecting various crops. To the best of our knowledge this is the first report of the natural occurrence of TSV in castor bean.

Genetic variability of tobacco streak virus in South India based on the analysis of coat protein gene

Tobacco streak virus (TSV), a member of the genus Ilarvirus, family Bromoviridae is an important viral pathogen in peanut and other crops in South India. Fifteen TSV isolates naturally infecting groundnut, sunflower, onion, black gram, green gram, jute, tagetes, calotropis, pumpkin, watermelon and kenaf plants were collected from fields in different regions of Andhra Pradesh, Tamil Nadu and Karnataka. Virus was identified as TSV by direct antigen coating enzyme linked immunosorbent assay using TSV antiserum. The CP gene from each isolate was amplified using TSV coat protein specific primers. About 700 bp product was amplified, cloned, sequenced and determined its length as 717 nucleotides and codes for 239 amino acids. The sequence analysis revealed that the CP gene shared 91–100% and 91–99% sequence identity with TSV at nucleotide and amino acid level, respectively. The phylogenetic relationship based on the nucleotide sequence of these isolates from different geographical regions was also analysed in this study.

FIRST REPORT OF TOBACCO STREAK VIRUS INFECTING CYAMOPSIS TETRAGONOLOBA

Guar (Cyamopsis tetragonoloba), family Fabaceae, is a drought-tolerant annual legume crop known as cluster bean, grown in tropical and sub tropical regions of the world. In India 1.93 million tonnes are produced on a surface of 3.86 million ha. Guar is extensively used by paper, mining, food, cosmetic, textile, oil and pharmaceutical industries (Hymowitz and Matlock, 1963). In November 2011, foliar mosaic and necrotic spotting as well as necrotic streaks on buds and stems were observed in guar fields of Chittoor district of Andhra Pradesh (India). Based on symptomatology, infections by Tobacco streak virus (TSV) a mem- ber of the genus Ilarvirus, family Bromoviridae were suspected. The presence of the virus was confirmed in symptomatic leaves by direct antigen coating (DAC)-ELISA using TSV polyclonal antibodies. RT-PCR amplification using as template total RNA isolated from leaf tissue and primers specific for the coat protein gene of TSV (Bhat et al., 2002) resulted in an amplicon of the ex- pected size (ca. 700 bp). The PCR product was cloned into pTZ57R/T vector (Fermentas, USA) and sequenced (GenBank accession No. JQ269831). Sequence analysis (BioEdit v. 7.05) dis- closed 98.8-99.8% and 97.8-100% identity at the nucleotide and amino acid levels, respectively, with the coat protein gene of 16 other TSV isolates. Phylogenetic trees constructed using MEGA version 4.0, showed clustering of the TSV isolate from guar with another isolate from sun-hemp (AF515825). To the best of our knowledge this is the first report of the natural occurrence of TSV on guar.

Effect of prostaglandins on characteristics of buffalo semen at 4°C

The effect was studied of exogenously added prostaglandins (PGs) E2 and/or F2α at different concentrations on certain characters of diluted semen of Murrah buffalo breeding bulls at 0, 24, 48 and 72 h of incubation. It was observed that the presence of PGE2 alone and PGE2 in combination with PGF2α were significantly beneficial for the maintenance of motility and viability of sperm (P < 0.01). While the proportion of abnormal sperm remained the same in all the treatment groups at all storage periods, the percentage of acrosomal changes did not vary between treatments.

Biochemical Variability and Seed Yield of Resistant and Susceptible Black Gram (Vigna mungo (L.) Hepper) Genotypes Elicited by Bemisia tabaci (Gennadius)

Plants face several challenges in terms of biotic stress due to insect pests. However, plants make use of a wide range of physiochemical mechanisms to protect themselves against such biotic stresses induced by insect pests. The resistance strategies could be constitutive, that is, they are always present in the plant independent of herbivore attack, or inducible, activated only when the plant is attacked (Kessler and Baldwin, 2002). Accumulation of defensive compounds through physiological, morphological, and chemical changes is the most vital line of defense in plants against insect attack. Various biochemical constituents present in the cells and tissues of the host plant exert a profound influence on biology of insect pests (Sharma, 2009). Blackgram (Vigna mungo (L.) Hepper) is an important legume crop cultivated worldwide International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 7 Number 08 (2018) Journal homepage: http://www.ijcmas.com