L. Prasanthi

Mungbean yellow mosaic India virus is associated with yellow mosaic disease of blackgram (Vigna mungo L.) in Andhra Pradesh, India

To study the variability and to identify the species of Begomovirus associated with yellow mosaic disease of blackgram in Andhra Pradesh, India, infected blackgram samples were collected from six districts belonging to three regions of Andhra Pradesh. The total DNA was isolated by modified CTAB method and amplified with coat protein gene-specific primers (RHA-F and AC abut) resulting in 900 bp gene product. The PCR products were cloned, sequenced and deposited in GenBank. The sequence analysis of six clones showed that the size of amplified CP gene of YMV was 920 bp. Based on nucleotide sequence identity of six isolates representing three regions of Andhra Pradesh, the isolates from Rayalaseema and Telangana region are the same variant of YMV (>99.5% identity) and isolate from coastal Andhra is another variant of YMV (>95.4%) when compared with other region isolates. Comparison of CP gene sequence of YMV-TPT isolate with 27 other isolates in database revealed more than 93.2 and 86.2% identity with MYMIV isolates and less than 80 and 64% identity with MYMY isolates that originate from Indian sub-continent and South-East Asia at nucleotide and amino acid level, respectively. Phylogenetic tree based on CP gene sequences of six isolates with other isolates from GenBank formed unique cluster with MYMIV. Hence the YMV infecting blackgram in Andhra Pradesh is caused by MYMIV rather than MYMY as reported in Tamil Nadu which is adjoining state in southern India.

FIRST REPORT OF TOBACCO STREAK VIRUS IN CASTOR BEAN

Castor bean (Ricinus communis L.), family Euphorbiaceae, is indigenous to the southeastern Mediterranean Basin, India and East Africa. India is the world leader in castor bean production with 2.25 million tonnes in 2011, followed by China and Brazil. In March 2013, necrotic spots and vein mosaic were observed on the lower side of the leaves in a castor bean field at the Regional Agricultural Research Station, Tirupati, India. Based on the symptomatology, infection by Tobacco streak virus (TSV, genus Ilarvirus, family Bromoviridae) was suspected. The presence of TSV in symptomatic leaves was ascertained by DAS-ELISA using TSV polyclonal antibodies. RT-PCR using total RNA isolated from leaf tissue by the Trizol method and primers specific for the coat protein gene of TSV (CP-F, 5’AGCAGATGCCCAACTTGTTT3’; CP-R, 5’AAGGGAGCTGGTTTGGATA3’) (Bhat et al., 2002) yielded a product 602 bp in size. The amplicon was cloned in pTZ57R/T vector (Fermentas, USA) and sequenced. The nucleotide sequence was deposited in GenBank as accession No. KC683810. Sequence analysis (BioEdit V7.0.5) showed more than 99% identity at the nucleotide level with 15 other TSV isolates infecting various crops. To the best of our knowledge this is the first report of the natural occurrence of TSV in castor bean.

Association and path analysis in F2 populations of pigeonpea [Cajanus cajan (L.) Millsp]

Genetic association among 11 F2 population derived from 8 parental lines of pigeonpea was carried out for 11 characters. The correlation study revealed highest positive correlation for pods per plant and branches per plant in parents and also in addition to these 100-seed weight in F2 progenies revealed that these characters may be considered for improvement of yield. Pods per plant recorded the highest direct effect on seed yield followed by pod length, seeds per pod, plant height and branches per plant while SCMR at 50 per cent flowering showed negative direct effect on seed yield.