Bertha Ibarra

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

Alpha‐thalassemia (α‐thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α‐thal and beta‐thalassemia (β‐thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α‐ and β‐thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2.

HB Fannin-Lubbock-I with A Single GGC>GAC Mutation at β119(GH2)Gly→Asp in a Homozygous Mexican Patient

We studied a fast-moving, abnormal hemoglobin (Hb) identified as Fannin–Lubbock-I [β119(GH2)Gly→Asp] in a homozygous Mexican girl. To date, homozygosity for the Hb Fannin-Lubbock-I variant has not been reported. Her parents and five other relatives were heterozygotes. The 5′ β-globin haplotype analysis showed that the mutation was associated with haplotype 2 [− + + − +]for the ε, Gγ, Aγ, 5′ and 3 ′ψβ-globin sites, and also segregated with the TGTTC haplotype, which was constructed with five polymorphic sites of the β-globin gene [exon 1-nucleotide (nt) 6 (C>T) and IVS-II-16 (C>G), IVS-II-46 (T>C), IVS-II-74 (G>T), and IVS-II-81 (C>T). In 1994, a variant with an additional mutation at codon 111 [β111(G13)Val→Leu] was described in five Spanish families. This variant was termed Hb Fannin-Lubbock-II, and the question of the existence of Hb Fannin-Lubbock-I arose. However, based on our findings, we were able to confirm the existence of Hb Fannin-Lubbock-I and propose that this mutation has a different origin from the one identified in Spanish families.

A Pilot Genome-Wide Association Study in Postmenopausal Mexican-Mestizo Women Implicates the RMND1/CCDC170 Locus Is Associated with Bone Mineral Density

To identify genetic variants influencing bone mineral density (BMD) in the Mexican-Mestizo population, we performed a GWAS for femoral neck (FN) and lumbar spine (LS) in Mexican-Mestizo postmenopausal women. In the discovery sample, 300,000 SNPs were genotyped in a cohort of 411 postmenopausal women and seven SNPs were analyzed in the replication cohort (n = 420). The combined results of a meta-analysis from the discovery and replication samples identified two loci, RMND1 (rs6904364, P = 2.77 × 10−4) and CCDC170 (rs17081341, P = 1.62 × 10−5), associated with FN BMD. We also compared our results with those of the Genetic Factors for Osteoporosis (GEFOS) Consortium meta-analysis. The comparison revealed two loci previously reported in the GEFOS meta-analysis: SOX6 (rs7128738) and PKDCC (rs11887431) associated with FN and LS BMD, respectively, in our study population. Interestingly, rs17081341 rare in Caucasians (minor allele frequency < 0.03) was found in high frequency in our population, which suggests that this association could be specific to non-Caucasian populations. In conclusion, the first pilot Mexican GWA study of BMD confirmed previously identified loci and also demonstrated the importance of studying variability in diverse populations and/or specific populations.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients

Beta‐thalassemia (β‐thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population.