Josefina Yoaly Sánchez-López

Analysis of the SLC4A1 gene in three Mexican patients with hereditary spherocytosis: report of a novel mutation

We analyzed the SLC4A1 gene in three Mexican patients with Hereditary Spherocytosis (HS). The promoter and all 20 exons were investigated through heteroduplex analysis and DNA sequencing. No DNA changes were detected in one of the three patients. Two well-known polymorphisms, Memphis I and the Diego-a blood group, were detected in another one. In the third, the HS phenotype could be explained by the novel 1885_1888dupCCGG mutation found in heterozygosis. This frameshift mutation is predicted to result in a truncated and unstable protein lacking normal functions.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

Alpha‐thalassemia (α‐thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α‐thal and beta‐thalassemia (β‐thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α‐ and β‐thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2.

Characterization of the 5′ and 3′ Breakpoints of the Spanish (δβ)0-Thalassemia Deletion in Mexican Patients

We studied five unrelated Mexican carriers of the Spanish (δβ)0-thalassemia [(δβ)0-thal] mutation to characterize the size of the deletion, the 5′ and 3′ breakpoints and the 5′ β-globin haplotype. Sequence analysis revealed the presence of an 89,548 bp deletion. The δ- and β-globin genes, two olfactory receptor genes (OR51V1 and OR52A1) and two pseudogenes (OR52Z1P and OR51A1P) were deleted. The 5′ breakpoint was located at the same position as previously reported, and the 3′ breakpoint was situated 7.0 kb downstream of OR52A1 and 11.7 kb upstream of OR52A5. The Spanish (δβ)0-thal allele was associated with the 5′ haplotype 2 [– + + – +] in the studied patients. Because this mutation is relatively frequent in Spain, and the Mexican population contains a high level of Spanish genetic background, we propose that the mutation in both populations share a common ancestral origin.

The human epidermal receptors in gastric cancer: molecular alterations and its role as therapeutic targets

Andrea Rebeca Bustos-Carpinteyro1,2, María Teresa Magaña-Torres1, Juan Ramón González-García1, Juan Heriberto Torres-Jasso3 and Josefina Yoaly Sánchez-López1 1Division of Genetics, Biomedical Research Center of the West, Instituto Mexicano del Seguro Social; 2Human Genetics Doctorate Program, University Center of Health Sciences, Universidad de Guadalajara. Guadalajara, Jal.; 3Department of Biological Sciences, Division of Biological Sciences and Health, University Center of the Coast, Universidad de Guadalajara, Delegación Ixtapa, Puerto Vallarta, Jal. Mexico

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients

Beta‐thalassemia (β‐thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population.

A Novel 31.1 kb α-Thalassemia Deletion (– –MEX3) Found in a Mexican Family

Abstract α-Thalassemia (α-thal), a genetic disease characterized by microcytosis, hypochromia and anemia, is predominantly caused by deletions of the α-globin genes, HBA2 and HBA1. In this study, we describe a novel 31.1 kb α-thal deletion, – –MEX3 (NC_000016.10: g.151479_182582del), observed in a Mexican family, probably originated from non homologous recombination between two Alu sequences; the 5′ Alu element has been involved in at least two other α-thal deletions [– –FIL (NG_000006.1: g.11684_43534del) and – –KOL] and possesses a core homologous sequence next to the – –MEX3 breakpoint. In addition, a 286 bp insertion in an Alu sequence downstream to the – –MEX3 3′ breakpoint was found in the studied family, – –FIL carriers, and healthy subjects, suggesting a common genetic variation in the Mexican population. We highlight the involvement of Alu elements and their core sequence in the origin of deletions in the α-globin gene cluster, and the importance of characterizing rare mutations, to better understand DNA rearrangement origins.

Epidermal growth factor receptor expression in gastric tumors and its relationship with the germline polymorphisms - 216 G>T, -191 C>A, (CA) n IVS1, and R521K.

BACKGROUND Gastric cancer (GC) is the third worldwide leading cause of cancer-related death affecting both sexes. The aberrant expression of epidermal growth factor receptor (EGFR) gene has been detected in many human epithelial malignancies and linked to advanced disease, more aggressive phenotype, and poor prognosis. AIMS To analyze the relation that the expression of EGFR in gastric tumors holds with pathological characteristics and with the germline polymorphisms -216 G>T, -191 C>A, (CA) n IVS1, and R521K. MATERIALS AND METHODS We studied 22 biopsies from gastric tumors obtained by endoscopy. EGFR expression was determined by relative quantification real-time polymerase chain reaction with the glyceraldehyde-3-phosphate dehydrogenase reference gene (as for messenger RNA [mRNA]) and by immunohistochemistry (IHC) (as for protein). EGFR germline polymorphisms were analyzed by sequencing, GeneScan, and restriction fragment length polymorphisms. RESULTS EGFR mRNA expression was increased (>2-fold) in 13.6% of GC cases, decreased (<0.5-fold) in 68.2%, and normal in 18.2%; overexpression was related to well-differentiated gastric tumors, whereas underexpression was linked to moderate or poorly differentiated gastric tumors (P < 0.001). EGFR protein expression was high (IHC 2+ and 3+) in 29.4% of gastric tumors and was normal or low (score 0 to 1+) in 70.6% cases. EGFR expression, in both mRNA and protein, was not related to any EGFR polymorphism (P > 0.05). CONCLUSIONS Most gastric tumors showed low EGFR expression (mRNA and protein), whereas EGFR overexpression was related to well-differentiated gastric tumors. Furthermore, germinal polymorphisms -216, -191, (CA) n IVS1, and R521K were not related to EGFR expression (mRNA or protein).