Bita Zamiri

The Disease-associated r(GGGGCC)n Repeat from the C9orf72 Gene Forms Tract Length-dependent Uni- and Multimolecular RNA G-quadruplex Structures

Background: The expanded C9orf72 (GGGGCC)n repeat causes amyotrophic lateral sclerosis and frontotemporal dementia. Results: The r(GGGGCC)n repeat forms stable, tract length-dependent unimolecular and multimolecular RNA G-quadruplexes. Conclusion: G-quadruplex formation by the r(GGGGCC)n repeats may contribute to normal and pathogenic functions of C9orf72. Significance: Understanding the RNA structures formed by this repeat may have implications for how repeat expansion causes disease. Certain DNA and RNA sequences can form G-quadruplexes, which can affect promoter activity, genetic instability, RNA splicing, translation, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia were recently shown to be caused by expansion of a (GGGGCC)n·(GGCCCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n-containing transcripts aggregate in nuclear foci possibly sequestering repeat-binding proteins, suggesting a toxic RNA pathogenesis. We demonstrate that the r(GGGGCC)n RNA but not the C-rich r(GGCCCC)n RNA forms extremely stable uni- and multimolecular parallel G-quadruplex structures (up to 95 °C). Multimolecular G-quadruplex formation is influenced by repeat number and RNA concentration. MBNL1, a splicing factor that is sequestered in myotonic dystrophy patients by binding to expanded r(CUG)n repeat hairpins, does not bind the C9orf72 repeats, but the splicing factor ASF/SF2 can bind the r(GGGGCC)n repeat. Because multimolecular G-quadruplexes are enhanced by repeat length, RNA-RNA interactions facilitated by G-quadruplex formation at expanded repeats might influence transcript aggregation and foci formation in amyotrophic lateral sclerosis-frontotemporal dementia cells. Tract length-dependent G-quadruplex formation by the C9orf72 RNA should be considered when assessing the role of this repeat in C9orf72 gene activity, protein binding, transcript foci formation, and translation of the C9orf72 product, including the noncanonical repeat-associated non-ATG translation (RAN translation) into pathologic dipeptide repeats, as well as any oligonucleotide repeat-based therapy.

TMPyP4 Porphyrin Distorts RNA G-quadruplex Structures of the Disease-associated r(GGGGCC)n Repeat of the C9orf72 Gene and Blocks Interaction of RNA-binding Proteins

Background: Amyotrophic lateral sclerosis and frontotemporal dementia are caused by expansion of the C9orf72 (GGGGCC)n repeat, whose RNA can form G-quadruplexes. Results: r(GGGGCC)n G-quadruplex distortion by TMPyP4 ablates interaction of the hnRNPA1 and ASF/SF2 proteins. Conclusion: G-quadruplexes can be modulated by TMPyP4, which can ablate protein interactions. Significance: Disruption of secondary structures in the C9orf72 RNA repeats may be a potential therapeutic avenue. Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

Regulatory Role of RNA Chaperone TDP-43 for RNA Misfolding and Repeat-Associated Translation in SCA31

Microsatellite expansion disorders are pathologically characterized by RNA foci formation and repeat-associated non-AUG (RAN) translation. However, their underlying pathomechanisms and regulation of RAN translation remain unknown. We report that expression of expanded UGGAA (UGGAAexp) repeats, responsible for spinocerebellar ataxia type 31 (SCA31) in Drosophila, causes neurodegeneration accompanied by accumulation of UGGAAexp RNA foci and translation of repeat-associated pentapeptide repeat (PPR) proteins, consistent with observations in SCA31 patient brains. We revealed that motor-neuron disease (MND)-linked RNA-binding proteins (RBPs), TDP-43, FUS, and hnRNPA2B1, bind to and induce structural alteration of UGGAAexp. These RBPs suppress UGGAAexp-mediated toxicity in Drosophila by functioning as RNA chaperones for proper UGGAAexp folding and regulation of PPR translation. Furthermore, nontoxic short UGGAA repeat RNA suppressed mutated RBP aggregation and toxicity in MND Drosophila models. Thus, functional crosstalk of the RNA/RBP network regulates their own quality and balance, suggesting convergence of pathomechanisms in microsatellite expansion disorders and RBP proteinopathies.

Quadruplex formation by both G-rich and C-rich DNA strands of the C9orf72 (GGGGCC)8•(GGCCCC)8 repeat: effect of CpG methylation

Unusual DNA/RNA structures of the C9orf72 repeat may participate in repeat expansions or pathogenesis of amyotrophic lateral sclerosis and frontotemporal dementia. Expanded repeats are CpG methylated with unknown consequences. Typically, quadruplex structures form by G-rich but not complementary C-rich strands. Using CD, UV and electrophoresis, we characterized the structures formed by (GGGGCC)8 and (GGCCCC)8 strands with and without 5-methylcytosine (5mCpG) or 5-hydroxymethylcytosine (5hmCpG) methylation. All strands formed heterogenous mixtures of structures, with features of quadruplexes (at pH 7.5, in K+, Na+ or Li+), but no feature typical of i-motifs. C-rich strands formed quadruplexes, likely stabilized by G•C•G•C-tetrads and C•C•C•C-tetrads. Unlike G•G•G•G-tetrads, some G•C•G•C-tetrad conformations do not require the N7-Guanine position, hence C9orf72 quadruplexes still formed when N7-deazaGuanine replace all Guanines. 5mCpG and 5hmCpG increased and decreased the thermal stability of these structures. hnRNPK, through band-shift analysis, bound C-rich but not G-rich strands, with a binding preference of unmethylated > 5hmCpG > 5mCpG, where methylated DNA-protein complexes were retained in the wells, distinct from unmethylated complexes. Our findings suggest that for C-rich sequences interspersed with G-residues, one must consider quadruplex formation and that methylation of quadruplexes may affect epigenetic processes.

Concentration-dependent conformational changes in GQ-forming ODNs

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.

Stress-induced acidification may contribute to formation of unusual structures in C9orf72-repeats

BACKGROUND Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH 4.5-6.2), facilitating the formation of intercalated i-motif structures. METHODS Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer. RESULTS We show that the repeats with lengths of 4, 6, and 8 units, form intercalated quadruplex i-motifs at low pH (pH < 5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH ≥ 8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures. CONCLUSIONS In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo. GENERAL SIGNIFICANCE DNA conformational plasticity exists over broad range of solution conditions.

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72

BACKGROUND An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. METHODS Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K+. RESULTS The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. CONCLUSIONS For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules.