Robert B. Macgregor

Origins of Pressure-Induced Protein Transitions

The molecular mechanisms underlying pressure-induced protein denaturation can be analyzed based on the pressure-dependent differences in the apparent volume occupied by amino acids inside the protein and when they are exposed to water in an unfolded conformation. We present here an analysis for the peptide group and the 20 naturally occurring amino acid side chains based on volumetric parameters for the amino acids in the interior of the native state, the micelle-like interior of the pressure-induced denatured state, and the unfolded conformation modeled by N-acetyl amino acid amides. The transfer of peptide groups from the protein interior to water becomes increasingly favorable as pressure increases. Thus, solvation of peptide groups represents a major driving force in pressure-induced protein denaturation. Polar side chains do not appear to exhibit significant pressure-dependent changes in their preference for the protein interior or solvent. The transfer of nonpolar side chains from the protein interior to water becomes more unfavorable as pressure increases. We conclude that a sizeable population of nonpolar side chains remains buried inside a solvent-inaccessible core of the pressure-induced denatured state. At elevated pressures, this core may become packed almost as tightly as the interior of the native state. The presence and partial disappearance of large intraglobular voids is another driving force facilitating pressure-induced denaturation of individual proteins. Our data also have implications for the kinetics of protein folding and shed light on the nature of the folding transition state ensemble.

Formation and structural determinants of multi-stranded guanine-rich DNA complexes.

We have investigated the complexes formed by oligonucleotides with the general sequence d(T15,Gn), where n = 4-15. Two distinct classes of structures are formed, namely, the four-stranded tetraplex and frayed wires. Frayed wires differ from four-stranded tetraplexes in both strand association stoichiometry and the ability of dimethyl sulfate to methylate the N7 position of guanine. Thus, it appears that these two guanine-rich multistranded assemblies are stabilised by different guanine-guanine interactions. The number of contiguous guanine residues determines which of the complexes is favoured. Based on the stoichiometry of the associated species and the accessibility of the N7 position of guanine to methylation we have found that oligonucleotides with smaller number of contiguous guanines; n = 5-8, form primarily four-stranded tetraplex. Oligonucleotides with larger numbers of contiguous guanines adapt primarily the frayed wire structure. The stability of the complexes formed by this series of oligonucleotides is determined by the number and arrangement of the guanines within the sequences. We propose that the formation of the two types of complex proceed by a parallel reaction pathways that may share common intermediates.

Effect of cations on the volume of the helix-coil transition of poly[d(A-T)]

The pressure dependence of the helix-coil transition temperature of poly[d(A-T)] has been measured in aqueous solutions of NaCl, KCl, and CsCl at concentrations between 0.02 and 1 M. In all cases the transition temperature increases with pressure. For solutions of NaCl, KCl and dilute CsCl the change in the transition temperature is linear with pressure up to 200 MPa. In more concentrated CsCl solutions the change in Tm with pressure was hyperbolic. The molar volume change of the transition (delta Vt) was calculated using the Clapeyron equation. At the lower salt concentrations, the derived values of delta Vt increase with the radius of the cation (Na+ < K+ < Cs+). At the higher salt concentrations delta Vt of poly[d(A-T)] in Na+ and K+ became equal; however, in CsCl solutions delta Vt was approximately twice as large as delta Vt in solutions containing the other two ions. In solutions of NaCl and KCl, delta Vt increased linearly with the logarithm of the salt concentration while in aqueous CsCl the concentration dependence of delta Vt was hyperbolic. The results are interpreted in terms of the role played by the radius of the cation in deciding the strength of the interactions formed with water.

Structural polymorphism of the four-repeat Oxytricha nova telomeric DNA sequences

G-quadruplexes are four-stranded nucleic acid complexes that exhibit a great deal of polymorphism. Recently a group described the polymorphism exhibited by the four-repeat of the Oxytricha nova telomeric sequences (Lee, J.Y., Yoon, J., Kihm, H.W., Kim, D.S., Biochemistry 2008, 47, 3389-3396). In this study we evaluated the effects of G-tract and loop lengths on this behaviour using circular dichroism (CD) and gel electrophoresis. The largest changes were detected for oligonucleotides with different numbers of consecutive G residues. Furthermore, decreasing the number of residues between the G runs, the loops, from four to three only results in minor alteration in the polymorphism. However, the shortening of the G-tract from four to three guanine residues led to characteristically anti-parallel G-quadruplex CD spectra. Finally, we show that adenine bases in the loop sequences are less likely to form G-quadruplexes in the presence of Na(+) cations than those comprised of thymine residues. The results presented here are an addition to the modest information available for predicting the type of G-quadruplex to be formed from G-rich sequences in aqueous solutions containing sodium or potassium ions.

Thermal activation of DNA frayed wire formation

Dynamic light scattering has been used to study the formation of stable multistranded DNA complexes called frayed wires. DNA frayed wires arise from the indefinite self-association of oligonucleotides with long terminal tracks of guanines, e.g. d(A15G15). The complexes are stabilized via guanine-guanine interactions resulting in the formation of a guanine stem. Non-guanine portions of the oligonucleotide are disposed away from the stem and form single stranded arms. The indefinite nature of the self-association of these oligonucleotides leads to a distribution of aggregate molecular weights. The distribution arises from aggregated species that differ from one another by the number of self-associated oligonucleotides. In light-scattering experiments, the autocorrelation functions collected for frayed wires are bimodal. The slow mode, often observed for samples containing DNA and other polyelectrolytes, has been ascribed to the formation of large unspecific aggregates due to electrostatic or other long-range interactions. We attribute the fast mode to the translational diffusion of the polydisperse population in the frayed wire sample. We use the mean of the fast mode to characterize the growth of the frayed wires. Consistent with the gel electrophoresis studies, the aggregation of frayed wires is promoted by the presence of magnesium ions and incubation at high temperature. The rate of aggregate formation increases with temperature, indicating the positive activation energy for the reaction. We propose an energy diagram for the formation/disruption of frayed wires revealing the catalytic-like role of the complementary strand in the denaturation of high molecular weight complexes.

Commentary: The DNA double helix fifty years on

This year marks the 50th anniversary of the proposal of a double helical structure for DNA by James Watson and Francis Crick. The place of this proposal in the history and development of molecular biology is discussed. Several other discoveries that occurred in the middle of the twentieth century were perhaps equally important to our understanding of cellular processes; however, none of these captured the attention and imagination of the public to the same extent as the double helix. The existence of multiple forms of DNA and the uses of DNA in biological technologies is presented. DNA is also finding increasing use as a material due to its rather unusual structural and physical characteristics as well as its ready availability.

Concentration-dependent conformational changes in GQ-forming ODNs

Guanine-rich oligodeoxyribonucleotides (ODNs) can form non-canonical DNA structures known as G-quadruplexes, which are four stranded structures stabilized by sodium or potassium cations. The topologies of G-quadruplexes are highly polymorphic. H-Tel, an ODN with four consecutive repeats of the human telomeric sequence, [d(AGGGTTAGGGTTAGGGTTAGGG)], can assume different monomolecular G-quadruplex topologies depending on the type of cation present in solution. Our previous work demonstrated that at high concentrations of H-Tel, the monomolecular G-quadruplexes formed by H-Tel self-associate to form higher order structures. The aggregates display circular dichroism (CD) spectra similar to that of an all-parallel structure. In the current work, we present data for 19 ODNs for which we have modified the loop sequences of H-Tel in order to learn if concentration-dependent self-aggregation is a general phenomenon and to probe the contribution of the loops to the self-association of these ODNs. Our studies use CD spectroscopy and spectroscopically monitored heat denaturation. Our data show that the concentration-dependent formation of parallel G-quadruplex aggregates is a general phenomenon. We propose that one of the factors that might affect this process is the association of partially unfolded antiparallel structures.

Pressure-induced helix–coil transition of DNA copolymers is linked to water activity

We have investigated the effect of reduced water activity on the pressure-stability of double-stranded DNA polymers, poly[d(A-T)] and poly[d(I-C)]. Water activity was modulated by the addition of ethylene glycol and glycerol. The ionic strength of the medium was such that pressure had a destabilising effect on the polymers in the absence of cosolvents. The molar volume change of the heat-induced helix to coil transition (DeltaV(T)) becomes more positive as the activity of water was reduced, suggesting that the pressure-induced denaturation of DNA polymers would not occur at very low water activity. This would imply that water plays a crucial role in the pressure denaturation of DNA, much like that in pressure denaturation of proteins where the driving force of the process is the penetration of water molecules into the protein core [Hummer et al., Proc Natl Acad Sci USA 1998, 95, 1552-1555].

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72

BACKGROUND An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. METHODS Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K+. RESULTS The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. CONCLUSIONS For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules.

A look at the effect of sequence complexity on pressure destabilisation of DNA polymers

Our previous studies on the helix-coil transition of double-stranded DNA polymers have demonstrated that molar volume change (ΔV) accompanying the thermally-induced transition can be positive or negative depending on the experimental conditions, that the pressure-induced transition is more cooperative than the heat-induced transition [Rayan and Macgregor, J Phys Chem B2005, 109, 15558-15565], and that the pressure-induced transition does not occur in the absence of water [Rayan and Macgregor, Biophys Chem, 2009, 144, 62-66]. Additionally, we have shown that ΔV values obtained by pressure-dependent techniques differ from those obtained by ambient pressure techniques such as PPC [Rayan et al. J Phys Chem B2009, 113, 1738-1742] thus shedding light on the effects of pressure on DNA polymers. Herein, we examine the effect of sequence complexity, and hence cooperativity on pressure destabilisation of DNA polymers. Working with Clostridium perfringes DNA under conditions such that the estimated ΔV of the helix-coil transition corresponds to -1.78 mL/mol (base pair) at atmospheric pressure, we do not observe the pressure-induced helix-coil transition of this DNA polymer, whereas synthetic copolymers poly[d(A-T)] and poly[d(I-C)] undergo cooperative pressure-induced transitions at similar ΔV values. We hypothesise that the reason for the lack of pressure-induced helix-coil transition of C. perfringens DNA under these experimental conditions lies in its sequence complexity.