Carla Valsecchi

Deamino-8-D-arginine vasopressin shortens the bleeding time in uremia

In a randomized double-blind cross-over trial we gave either 1-deamino-8-D-arginine vasopressin or placebo to 12 patients with uremia, hemorrhagic tendencies, and prolonged bleeding times. After vasopressin infusion, all patients had shortened bleeding times, with the effect lasting for at least four hours in most cases. Platelet count, platelet cyclic AMP levels, platelet retention on glass beads, plasma fibronectin, serum thromboxane B2 and residual prothrombin, hematocrit, and plasma osmolarity were unchanged after vasopressin. A consistent post-infusion increase in factor VIII coagulant activity and, to a lesser extent, in factor VIII-related antigen and ristocetin cofactor accompanied the shortening of bleeding time. In addition, vasopressin induced the appearance in plasma of larger von Willebrand-factor multimers than those present in the resting state. The compound was given to nine additional patients with acute or chronic renal failure and prolonged bleeding times, before major surgery or renal biopsy. In these patients, shortening of the bleeding time was associated with normal hemostasis. Our findings indicate that 1-deamino-8-D-arginine vasopressin can be used for temporary correction of bleeding time and may prevent surgical bleeding in patients with uremia.

ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission

Acquired thrombotic thrombocytopenic purpura (TTP) is often due to anti-ADAMTS13 antibodies that inhibit the proteolytic activity of the plasma metallo-protease and/or accelerate its clearance. Survivors of an acute episode of TTP with severely reduced levels of ADAMTS13 and /or with anti-ADAMTS13 antibodies during remission are at high risk of developing another epidode of TTP. Background From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established. Design and Methods In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients. Results Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence. Conclusions Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

ADAMTS‐13 activity and autoantibodies classes and subclasses as prognostic predictors in acquired thrombotic thrombocytopenic purpura

Summary.  Background:  Thrombotic thrombocytopenic purpura (TTP) is a rare life‐threatening disease. Of surviving patients, 45% develops an exacerbation or a late recurrence. Severe ADAMTS‐13 deficiency, both during the acute episode and remission, is a well‐established predictor of recurrence. The predictive value of anti‐ADAMTS‐13 antibodies, their inhibitory activity and Ig class subtype for disease recurrence is still to be established.

Next‐generation sequencing study finds an excess of rare, coding single‐nucleotide variants of ADAMTS13 in patients with deep vein thrombosis

The considerable genetic predisposition to deep vein thrombosis (DVT) is only partially accounted for by known genetic risk variants. Rare single‐nucleotide variants (SNVs) of the coding areas of hemostatic genes may explain part of this missing heritability. The ADAMTS13 and VWF genes encode two interconnected proteins with fundamental hemostatic functions, the disruption of which may result in thrombosis.

Reduced free protein S levels in patients with inflammatory bowel disease: prevalence, clinical relevance, and role of anti-protein S antibodies.

We evaluated free plasma levels of protein S, a natural anticoagulant factor, the prevalence of anti-protein S antibodies, a possible cause of protein S deficiency, and their correlation with anti-phospholipid antibodies in 53 patients with inflammatory bowel disease (IBD) and 53 age- and sex-matched controls. Mean free plasma protein S levels (± sd) were significantly lower in IBD patients (0.98 ± 0.32 IU/ml) than in controls (1.06 ± 0.28 IU/ml) (P < 0.05); only one patient showed protein S deficiency. Specific antibodies to protein S were found in four IBD patients (7.5%) and in one control (1.9%) (P = NS). Five IBD patients (9.4%) and none of the controls showed anti-phospholipid antibodies (P < 0.06). No correlation was found between free protein S levels and anti-protein S antibodies or between anti-protein S and anti-phospholipid antibodies. In conclusion, free plasma protein S levels are slightly but significantly decreased in IBD patients. The prevalence of anti-protein S and anti-phospholipid antibodies is increased in IBD patients. Anti-protein S antibodies do not appear to determine low protein S levels or to overlap with or belong to anti-phospholipid antibodies.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

This study demonstrates that two cases of severe ADAMTS13 deficiency are mechanistically caused by the association of two different gene defects acting at two different levels. Background In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. Design and Methods In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. Results In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. Conclusions In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Evaluation of assay methods to measure plasma ADAMTS13 activity in thrombotic microangiopathies

Evaluation of assay methods to measure plasma ADAMTS13 activity in thrombotic microangiopathies -

Measurement and prevalence of circulating ADAMTS13-specific immune complexes in autoimmune thrombotic thrombocytopenic purpura

The formation of ADAMTS13‐specific circulating immune complexes (CICs) may be a pathophysiologic mechanism in autoimmune thrombotic thrombocytopenic purpura (TTP), but has not been systematically investigated.

ADAMTS13 content in plasma-derived factor VIII/von Willebrand factor concentrates

Thrombotic thrombocytopenic purpura (TTP) is a microangiopathy syndrome caused by a congenital or acquired deficiency of ADAMTS13, a plasma metalloprotease that cleaves von Willebrand factor (VWF) and thus prevents the formation of platelet‐rich thrombi in the microcirculation. TTP can be fatal if not appropriately and timely treated with the infusion of fresh frozen plasma (FFP) or exchange plasmapheresis, that reverse the process of microangiopathy by removing anti‐ADAMTS13 autoantibodies and replacing functional ADAMTS13. The treatment of TTP with FFP is not free from risks and must be administered in hospitals or clinics, owing to the substantial amount of plasma volume infused or exchanged and the frequent need of catheter application. Moreover, most FFPs are not subjected to treatments to remove or inactivate blood‐borne infectious agents. A number of recent reports indicate that certain plasma‐derived VWF‐factor VIII (FVIII) concentrates are clinically effective in the treatment of congenital TTP. In this study, we measured ADAMTS13 levels in various plasma‐derived VWF‐FVIII concentrates, showing that Koate®‐DVI (Grifols), contained relatively high amounts of ADAMTS13 and that Alphanate® (Grifols) was the closest other product in terms of protease content. Koate®‐DVI contains, on average (five lots tested), 0.091 ± 0.007 Units of ADAMTS13 activity per IU of FVIII. On the basis of this analysis and other reports of VWF‐FVIII concentrate utilization in congenital TTP, potential dosing, and future clinical developments are discussed. Am. J. Hematol. 88:895–898, 2013.

Measurement of anti-ADAMTS13 neutralizing autoantibodies: a comparison between CBA and FRET assays

To cite this article: Mancini I, Valsecchi C, Palla R, Lotta LA, Peyvandi F. Measurement of anti‐ADAMTS13 neutralizing autoantibodies: a comparison between CBA and FRET assays. J Thromb Haemost 2012; 10: 1439–42.