Silvia Lavoretano

ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission

Acquired thrombotic thrombocytopenic purpura (TTP) is often due to anti-ADAMTS13 antibodies that inhibit the proteolytic activity of the plasma metallo-protease and/or accelerate its clearance. Survivors of an acute episode of TTP with severely reduced levels of ADAMTS13 and /or with anti-ADAMTS13 antibodies during remission are at high risk of developing another epidode of TTP. Background From 20 to 50% of patients who survive an acute episode of the acquired form of thrombotic thrombocytopenic purpura relapse but clinical and laboratory markers of recurrence are not well established. Design and Methods In 109 patients enrolled in an international registry we evaluated, in the frame of a retrospective cohort study, the predictive role of the metalloprotease ADAMTS13 as measured in plasma during remission. Anti-ADAMTS13 antibodies and von Willebrand factor were also evaluated in a smaller number of the same patients. Results Median values of ADAMTS13 activity and antigen were significantly lower in patients with recurrent thrombotic thrombocytopenic purpura than in those with no recurrence (activity: 12% vs. 41%; p=0.007; antigen: 36% vs. 58%; p=0.003). A severe deficiency of ADAMTS13 activity (10% or less) was associated with a higher likelihood of recurrence (odds ratio 2.9; 95% confidence interval 1.3 to 6.8; p=0.01). Anti-ADAMTS13 antibodies were also more prevalent in patients with recurrent thrombotic thrombocytopenic purpura (odds ratio 3.1; 95% confidence interval 1.4 to 7.3; p=0.006). The presence during remission of both severe ADAMTS13 deficiency and anti-ADAMTS13 antibodies increased the likelihood of recurrence 3.6 times (95% confidence interval 1.4 to 9.0; p=0.006). The presence of ultralarge von Willebrand factor multimers and of associated diseases or conditions did not increase recurrence. Conclusions Survivors of an acute episode of acquired thrombotic thrombocytopenic purpura with severely reduced levels of ADAMTS13 and/or with anti-ADAMTS13 antibodies during remission have an approximately three-fold greater likelihood of developing another episode of thrombotic thrombocytopenic purpura than patients with higher protease activity and no antibody.

von Willebrand factor cleaving protease (ADAMTS-13) and ADAMTS-13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura.

The congenital or acquired deficiency of the von Willebrand factor (VWF) cleaving protease, ADAMTS‐13 has been specifically associated with a diagnosis of thrombotic thrombocytopenic purpura (TTP), a microangiopathy characterized by the formation of occlusive platelet thrombi. The mechanisms of TTP were investigated in 100 patients diagnosed on the basis of the presence of at least three of the following: thrombocytopenia, haemolytic anaemia, elevated serum levels of lactate dehydrogenase and neurological symptoms. Plasma levels of ADAMTS‐13 were severely reduced (<10% of normal) in 48%, moderately reduced (between 10% and 46%) in 24% and normal (>46%) in 28%. A neutralizing antibody was the cause of the deficiency in 38% of the cases, with a higher prevalence of this mechanism (87%) in the 48 patients with severely reduced ADAMTS‐13. Double heterozygosity for a 29 base pair (bp) deletion and a nucleotide insertion and homozygosity for a 6 bp deletion in the ADAMTS13 gene were identified only in two patients born from consanguineous marriages. In conclusion, this study indicated that ADAMTS‐13 was normal in nearly one‐third of patients with TTP and that ADAMTS‐13 deficiency was not associated with the presence of neutralizing antibodies in more than half of the patients.

Genetic diagnosis of haemophilia and other inherited bleeding disorders

Summary.  Inherited deficiencies of plasma proteins involved in blood coagulation generally lead to lifelong bleeding disorders, whose severity is inversely proportional to the degree of factor deficiency. Haemophilia A and B, inherited as X‐linked recessive traits, are the most common hereditary hemorrhagic disorders caused by a deficiency or dysfunction of blood coagulation factor VIII (FVIII) and factor IX (FIX). Together with von Willebrands disease, a defect of primary haemostasis, these X‐linked disorders include 95% to 97% of all the inherited deficiencies of coagulation factors. The remaining defects, generally transmitted as autosomal recessive traits, are rare with prevalence of the presumably homozygous forms in the general population of 1:500.000 for FVII deficiency and 1 in 2 million for prothrombin (FII) and factor XIII (FXIII) deficiency. Molecular characterization, carrier detection and prenatal diagnosis remain the key steps for the prevention of the birth of children affected by coagulation disorders in developing countries, where patients with these deficiencies rarely live beyond childhood and where management is still largely inadequate. These characterizations are possible by direct or indirect genetic analysis of genes involved in these diseases, and the choice of the strategy depends on the effective available budget and facilities to achieve a large benefit. In countries with more advanced molecular facilities and higher budget resources, the most appropriate choice in general is a direct strategy for mutation detection. However, in countries with limited facilities and low budget resources, carrier detection and prenatal diagnosis are usually performed by linkage analysis with genetic markers. This article reviews the genetic diagnosis of haemophilia, genetics and inhibitor development, genetics of von Willebrands disease and of rare bleeding disorders.

Role of Chloride Ions in Modulation of the Interaction between von Willebrand Factor and ADAMTS-13

The degradation of von Willebrand factor (VWF) depends on the activity of a zinc protease (referred to as ADAMTS-13), which cleaves VWF at the Tyr1605-Met1606 peptide bond. Little information is available on the physiological mechanisms involved in regulation of AD-AMTS-13 activity. In this study, the role of ions on the ADAMTS-13/VWF interaction was investigated. In the presence of 1.5 m urea, the protease cleaved multimeric VWF in the absence of NaCl at pH 8.00 and 37 °C, with an apparent kcat/Km ≅ 3.4 × 104 m-1 s-1, but this value decreased by ∼10-fold in the presence of 0.15 m NaCl. Using several monovalent salts, the inhibitory effect was attributed mostly to anions, whose potency was inversely related to the corresponding Jones-Dole viscosity B coefficients (\batchmode \documentclass[fleqn,10pt,legalpaper]{article} \usepackage{amssymb} \usepackage{amsfonts} \usepackage{amsmath} \pagestyle{empty} \begin{document} \(\mathrm{ClO}_{4}^{-}{>}\mathrm{Cl}^{-}{>}\mathrm{F}^{-}\) \end{document}). The specific inhibitory effect of anions was due to their binding to VWF, which caused a conformational change responsible for quenching the intrinsic fluorescence of the protein and reducing tyrosine exposition to bulk solvent. Ristocetin binding to VWF could reduce the apparent affinity and reverse the inhibitory effect of chloride. We hypothesize that, after secretion into the extracellular compartment, VWF is bound by chloride ions abundantly present in this milieu, becoming unavailable to proteolysis by AD-AMTS-13. Shear forces, which facilitate GpIbα binding (this effect being artificially obtained by ristocetin), can reverse the inhibitory effect of chloride, whose concentration gradient across the cell membrane may represent a simple but efficient strategy to regulate the enzymatic activity of ADAMTS-13.

Prospective study on the behaviour of the metalloprotease ADAMTS13 and of von Willebrand factor after bone marrow transplantation

Thrombotic microangiopathies (TMAs) are rare but serious complications of bone marrow transplantation (BMT). Clinical manifestations are similar to those of thrombotic thrombocytopenic purpura (TTP), but prognosis is generally poorer despite plasma exchange. The enzymatic activity of the plasma metalloprotease ADAMTS13, which cleaves ultralarge thrombogenic multimers of von Willebrand factor (VWF) derived from activated endothelial cells, is very low or undetectable in patients with classic TTP, and protease deficiency is thought to play a mechanistic role in the formation of platelet thrombi in the microcirculation. This is the first prospective study to evaluate the incidence of TMA in 46 consecutively recruited patients undergoing autologous or allogeneic BMT and explore in parallel the behaviour of ADAMTS13, VWF antigen and VWF multimer size. The incidence of post‐BMT TMA was 6% (three of 46); all cases occurred after allogeneic BMT. Compared with baseline values plasma ADAMTS13 activity was significantly reduced in patients undergoing BMT, particularly after the conditioning regimen (mean values: 50 ± 22 vs. 77 ± 32%; P < 0·0001). In the three patients who developed TMA, ADAMTS13 decreased after conditioning, but was very low in one case only (8%). VWF antigen levels progressively increased after the conditioning regimen (228 ± 75 vs. 178 ± 76% at baseline, P = 0·002). The mean proportion of high‐molecular weight VWF multimers did not change in the various stages of BMT, even though ultralarge multimers were transiently found in same cases with and without TMA. Hence, the measurements evaluated in this study are not clinically useful to predict the occurrence of post‐BMT TMA.

The first deletion mutation in the TSP1-6 repeat domain of ADAMTS13 in a family with inherited thrombotic thrombocytopenic purpura

This report describes a novel mutation in the TSP1-6 domain of ADAMTS13 in a family with inherited thrombotic thrombocytopenic purpura. See related perspective article on page 166. The inherited deficiency of ADAMTS13 is usually associated with severe forms of thrombotic thrombocytopenic purpura. Among the mutations identified in the ADAMTS13 gene, none have been described on the TSP1-6 repeat domain. We investigated an Iranian family with a history of chronic recurrent thrombotic thrombocytopenic purpura, severe ADAMTS13 deficiency and a heterogeneous pattern of clinical symptoms among affected members. Genetic analysis revealed a homozygous deletion of nucleotides 2930–2935 (GTGCCC) in exon 23 of ADAMTS13, leading to the replacement of Cys977 by a Trp and the deletion of Ala978 and Arg979 in the TSP1-6 repeat domain. To explore the mechanism of ADAMTS13 deficiency, in vitro expression studies were performed. Western blotting, pulse-chase labeling and immunofluorescence studies demonstrated a secretion pathway defect of the mutant protein, with no intracellular accumulation. This finding is consistent with the severe ADAMTS13 deficiency but does not explain the heterogeneous clinical picture of the 3 siblings carrying the same mutation.

Nonsense-mediated mRNA decay in the ADAMTS13 gene caused by a 29-nucleotide deletion

This study demonstrates that two cases of severe ADAMTS13 deficiency are mechanistically caused by the association of two different gene defects acting at two different levels. Background In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. Design and Methods In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. Results In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. Conclusions In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.

Molecular mapping of the chloride-binding site in von Willebrand factor (VWF): Energetics and conformational effects on the VWF/ADAMTS-13 interaction

Physiological concentrations of NaCl inhibit the hydrolysis of von Willebrand factor (VWF) by ADAMTS-13. This effect is because of the specific binding of chloride ions to VWF. Urea-induced unfolding was measured in the presence of NaCl, CH3COONa, and NaClO4 at pH 8.0, 25 °C, for multimeric VWF, the recombinant A1-A2-A3 VWF domains, and the A1 domain. Chloride stabilizes the folded conformation of the A1-A2-A3 and A1 domains more efficiently than acetate but less strongly than perchlorate. Spectroscopic evidence showed that chloride binds to both the A1 and A1-A2 domain but not to the isolated A2 domain. Binding of Cl– to both wild type (WT) and the natural mutant p.R1306W A1-A2-A3 domains of VWF has a large heat capacity change equal to –1 and –0.4 kcal mol–1 K–1 for WT and p.R1306W A1-A2-A3 domains, respectively. This result implies that a burial of a vast apolar surface area is caused by conformational transitions linked to chloride binding. At any temperature, chloride affinity was higher for WT than for the mutant p.R1306W form. Chloride ions inhibit hydrolysis by ADAMTS-13 of the A1-A2-A3 and A1-A2 domains in the presence of either urea or high shear stress, whereas this effect was either absent or negligible in experiments using A2 and A2-A3 domains. These findings show that the A1 domain contains the binding site of chloride ions that control allosterically the proteolysis by ADAMTS-13 of the Tyr1605–Met1606 bond in the A2 domain and that the R1306W mutation of type 2B VWD quenches the binding of chloride ion to the A1 domain.

Phenotypic and genetic analysis of a compound heterozygote for dys- and hypoprothrombinaemia.

Summary. We studied a 2‐year‐old boy with a phenotype of combined hypo‐ and dysprothrombinaemia. Sequencing of polymerase‐chain‐reaction‐amplified genomic DNA revealed three different mutations in heterozygosity, a G to A transition at position 7312, resulting in the replacement of arginine 271 by histidine, an A to G transition at position 20058, resulting in the replacement of histidine 562 by arginine, and a 2‐bp deletion at 20062–20063, causing a frameshift and a premature stop codon in exon 14. The first two mutations are compatible with the dysprothrombinaemia phenotype, whereas the small deletion is thought to be the cause of hypoprothrombinaemia.