g-Jueng Chen

Polarized epithelial cells secrete matriptase as a consequence of zymogen activation and HAI-1-mediated inhibition

Matriptase, a transmembrane serine protease, is broadly expressed by, and crucial for the integrity of, the epithelium. Matriptase is synthesized as a zymogen and undergoes autoactivation to become an active protease that is immediately inhibited by, and forms complexes with, hepatocyte growth factor activator inhibitor (HAI-1). To investigate where matriptase is activated and how it is secreted in vivo, we determined the expression and activation status of matriptase in seminal fluid and urine and the distribution and subcellular localization of the protease in the prostate and kidney. The in vivo studies revealed that while the latent matriptase is localized at the basolateral surface of the ductal epithelial cells of both organs, only matriptase-HAI-1 complexes and not latent matriptase are detected in the body fluids, suggesting that activation, inhibition, and transcytosis of matriptase would have to occur for the secretion of matriptase. These complicated processes involved in the in vivo secretion were also observed in polarized Caco-2 intestinal epithelial cells. The cells target latent matriptase to the basolateral plasma membrane where activation, inhibition, and secretion of matriptase appear to take place. However, a proportion of matriptase-HAI-1 complexes, but not the latent matriptase, appears to undergo transcytosis to the apical plasma membrane for secretion. When epithelial cells lose their polarity, they secrete both latent and activated matriptase. Although most epithelial cells retain very low levels of matriptase-HAI-1 complex by rapidly secreting the complex, gastric chief cells may activate matriptase and store matriptase-HAI-1 complexes in the pepsinogen-secretory granules, suggesting an intracellular activation and regulated secretion in these cells. Taken together, while zymogen activation and closely coupled HAI-1-mediated inhibition are common features for matriptase regulation, the cellular location of matriptase activation and inhibition, and the secretory route for matriptase-HAI-1 complex may vary along with the functional divergence of different epithelial cells.

Molecular modulation of expression of prion protein by heat shock

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPC to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of −680 bp (HSE1; GGAACTATTCTTGACATTGCT), and −1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Prognostic prediction of the immunohistochemical expression of p53 and p16 in resected non-small cell lung cancer

OBJECTIVE p53 and p16(INK4) are the common and important tumor suppressor genes. Aberrant expression of p53 or p16 protein has been reported in various malignancies including lung cancer. Our aim was to investigate the association of p53 and p16 expression in resected non-small cell lung carcinoma (NSCLC) and evaluated their correlation with clinocopathologic features and survival. METHODS p16 and p53 expression were detected by immunohistochemical analysis of 90 paraffin specimens of resected NSCLC, including 35 squamous cell carcinoma, 47 adenocarcinoma, and eight large cell carcinoma, between stages I and IV. The immunohistochemical study was performed using the labeled streptavidine-biotin method with anti-p53 and anti-p16 monoclonal antibodies. RESULTS Fifty-two (57.8%) and 36 (40%) of 90 patients revealed aberrant immunostaining for p53 (p53+) and p16 (p16+), respectively. While 19 cases (21.1%) showed abnormal immunoreactivity for both p16 and p53. (p53+/p16+). There was no correlation of p53 or p16 expression with the clinicopathologic features. The Kaplan-Meier survival analysis demonstrated that patients with p16+, p53+, late stages, and nodal or distal metastasis had poor survival status (P = 0.006, 0.013, <0.001, <0.001 and 0.018, respectively). Further analysis demonstrated that p53 status was a significant prognostic factor in stage I NSCLCs (P < 0.001), and p16 status in stage I and II NSCLCs (P < 0.001, P = 0.003, respectively). Furthermore, patients whose tumors were both p53 and p16 aberrant expression had worse outcome compared with those whose tumors were both normal expression of p53 and p16 (5-year survival rate: 5 vs. 76%, P < 0.001). In Coxs regression model, the aberrant expression of p16, p53, advanced stages and combined aberrant expression of p53/p16 survived for a significant shorter period. CONCLUSIONS The results indicated that aberrant expression of p16 and p53 are significant and independent, predictable prognostic factors for resected NSCLC, especially in early stage of NSCLCs. The worst prognosis was seen in patients whose tumors had both aberrant expression of p53 and p16. Further prospective trials may be aimed at confirming and validating these results.

Increased matriptase zymogen activation in inflammatory skin disorders

Matriptase, a type 2 transmembrane serine protease, and its inhibitor hepatocyte growth factor activator inhibitor (HAI)-1 are required for normal epidermal barrier function, and matriptase activity is tightly regulated during this process. We therefore hypothesized that this protease system might be deregulated in skin disease. To test this, we examined the level and activation state of matriptase in examples of 23 human skin disorders. We first examined matriptase and HAI-1 protein distribution in normal epidermis. Matriptase was detected at high levels at cell-cell junctions in the basal layer and spinous layers but was present at minimal levels in the granular layer. HAI-1 was distributed in a similar pattern, except that high-level expression was retained in the granular layer. This pattern of expression was retained in most skin disorders. We next examined the distribution of activated matriptase. Although activated matriptase is not detected in normal epidermis, a dramatic increase is seen in keratinocytes at the site of inflammation in 16 different skin diseases. To gain further evidence that activation is associated with inflammatory stimuli, we challenged HaCaT cells with acidic pH or H(2)O(2) and observed matriptase activation. These findings suggest that inflammation-associated reactive oxygen species and tissue acidity may enhance matriptase activation in some skin diseases.

Microsatellite alterations on human chromosome 11 in in situ and invasive breast cancer: A microdissection microsatellite analysis and correlation with p53, ER (estrogen receptor), and PR (progesterone receptor) protein immunoreactivity

Microsatellite instability (MSI) has been documented in a subset of sporadic tumors. Loss of heterozygosity (LOH) on chromosome 11 loci in breast cancer is a frequent event. The purpose of the present study is to examine the incidence of microsatellite alterations in in situ and invasive human breast carcinoma and to clarify their significance in regulating the dynamics of cancer progression.

Strangulated transmesosigmoid hernia: CT diagnosis

We present a rare case of strangulated closed loop small bowel obstruction secondary to a trans-mesosigmoid hernia to emphasize the diagnostic role of computed tomography in patients with no history of previous surgery. The characteristic computed tomographic features showed a cluster of dilated, fluid-filled, U- and C-shaped loops of small bowel entrapped the left posterior and lateral to the sigmoid colon through a defect in the mesosigmoid, which caused anterior and medial displacement of the sigmoid colon.

Primary squamous cell carcinoma of the liver arising from a complex liver cyst : Report of a case

A 65-year-old man who had received radiation therapy for nasopharyngeal cancer (NPC) 3 years earlier presented with a 3-week history of right upper quadrant abdominal pain and a feeling of fullness. There had been no evidence of metastasis on his follow-up examinations. Computed tomography scan showed a huge complex cyst with septa in the right hepatic lobe, and we performed an extended right hepatectomy to relieve his symptoms. Pathological examination revealed a large hepatic cyst with malignant cells along the cyst wall. The cytokeratin stain and CK-14 stains were positive, indicating an undifferentiated squamous cell carcinoma (SCC). The final diagnosis of primary SCC of the liver was confirmed by the clinical pathological features and negative in situ hybridization of Epstein–Barr ribonucleic acids (EBERs). We used EBERs to determine whether the cystic tumor was a primary lesion or a metastatic lesion from the previous NPC.

Primary Malignant Mesothelioma of the Greater Omentum: Report of a Case

We report a rare case of primary malignant mesothelioma of the greater omentum. To our knowledge, only one other such case has been described in the English literature. The patient was a 61-year-old Taiwanese woman without any history of exposure to asbestos, who presented with lower back pain. Abdominal sonography and computed tomography showed a 12 × 9 × 9-cm3 mass occupying the lower abdomen. Laparotomy revealed a tumor in the greater omentum, invading the posterior wall of the uterus, without diffuse mesenteric thickening or multiple small nodules in the peritoneum. We performed en bloc resection of the mass, which involved omentectomy, hysterectomy, and bilateral salpingo-oophorectomy. Microscopically, the tumor cells were arranged in a tubulopapillary pattern lined by a single layer of uniform, cuboidal cells. A pattern of sclerotic stroma with irregular glandular elements was also recognized. Immunohistochemically, the tumor cells showed strong positivity for calretinin. The final pathologic diagnosis was malignant mesothelioma. The patient did not receive chemotherapy or radiotherapy, and has remained in good health without any evidence of recurrence for almost 3 years since her operation.

Microsatellite alteration at chromosome 11 in primary human nasopharyngeal carcinoma in Taiwan

Nasopharyngeal carcinoma (NPC) is one of the common cancers in Taiwan but is rare in western countries. The development of NPC involves multiple genetic changes in tumorigenesis and progression of the disease. To better understand genetic alterations in chromosome 11 which occur in human (NPC), we examined tumor specimens and corresponding non-cancerous tissue from 30 cases of NPC, using five microsatellite polymorphic markers whose location has previously been defined. To determine the clinical characteristics of MSI(+) or LOH, we performed correlation analysis of the findings with clinicopathological parameters. Loss of heterozygosity (LOH) was identified in 18 (60%) of 30 cases on at least one of the five markers. A high frequency of LOH was found at the two loci: D11S912 (7/30, 23.33%) and D11S934 (6/30, 20.00%), both of which are located within 11q23-24. We also found that 14 specimens (14/30, 46.67%) exhibited microsatellite instability (MSI(+)). Five (5/30, 16.67%) specimens exhibited MSI(+) in the transformation growth factor beta receptor type II (TGF-beta RII) exon 3 which also exhibited on chromosome 11. LOH was found to be significantly correlated with the T (tumor size) value (P=0.022) of Hos system. MSI(+) showed a significant correlation with the N (lymph node) value of the UICC system (P=0.031). Our results suggest that multiple putative tumor suppressor genes on chromosome 11 play a role in the development of NPC. MSI(+) expression showed a predisposition to occur in the late stage of NPC while LOH tended to occur in early stages of NPC. The behavior of mutated TGF-beta RII exon 3, which appeared to serve as a dysfunction brake during nasopharyngeal carcinogenesis, may be a target gene in the defected mismatch repair system.

Roux-en-Y reconstruction does not require gastric decompression after radical distal gastrectomy.

AIM To determine whether routine nasogastric (NG) decompression benefitted patients undergoing radical gastric surgery. METHODS Between January 1998 and December 2008, 519 patients who underwent distal gastrectomy for gastric cancer were retrospectively divided into 2 time-period cohorts; those treated with Billroth II (BII) reconstruction in the first 6 years and those with Roux-en-Y (RY) reconstruction in the last 5 years. In the latter group, the patients were further divided into 2 subgroups; with and without nasogastric decompression. RESULTS Postoperatively, there were no significant differences in the number of anastomotic leaks between the 3 groups. In the tubeless RY group, time to semi-liquid diet was significantly shorter than in the other 2 groups (4.4 d ± 1.4 d vs 7.2 d ± 1.3 d and 5.9 d ± 1.2 d, P = 0.005). The length of postoperative stay was significantly increased in patients with BII reconstruction compared with patients with RY reconstruction with/without NG decompression (15.4 d ± 4.3 d in BIIgroup vs 12.6 d ± 3.1 d in decompressed RY and 11.4 d ± 3.4 d in the tubeless RY group, P = 0.035). The postoperative pneumonia rate was lowest in the tubeless group and highest in the BII group (1.4% vs 4.6%, P = 0.01). Severe sore throat was noted in 59 (20.7%) members of the BII group, 18 (17.4%) members of the decompressed RY group and 6 (4.2%) members of the tubeless RY group. Fewer patients in the tubeless group complained of severe sore throat (P = 0.001). CONCLUSION This study provides support for abandoning routine NG decompression in patients undergoing subtotal gastrectomy with Roux-en-Y gastrojejunostomy.