Horng-Jyh Harn

Molecular modulation of expression of prion protein by heat shock

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrPSc. The conversion of PrPC to PrPSc is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP7O) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of −680 bp (HSE1; GGAACTATTCTTGACATTGCT), and −1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.

Prognostic prediction of the immunohistochemical expression of p53 and p16 in resected non-small cell lung cancer

OBJECTIVEnp53 and p16(INK4) are the common and important tumor suppressor genes. Aberrant expression of p53 or p16 protein has been reported in various malignancies including lung cancer. Our aim was to investigate the association of p53 and p16 expression in resected non-small cell lung carcinoma (NSCLC) and evaluated their correlation with clinocopathologic features and survival.nnnMETHODSnp16 and p53 expression were detected by immunohistochemical analysis of 90 paraffin specimens of resected NSCLC, including 35 squamous cell carcinoma, 47 adenocarcinoma, and eight large cell carcinoma, between stages I and IV. The immunohistochemical study was performed using the labeled streptavidine-biotin method with anti-p53 and anti-p16 monoclonal antibodies.nnnRESULTSnFifty-two (57.8%) and 36 (40%) of 90 patients revealed aberrant immunostaining for p53 (p53+) and p16 (p16+), respectively. While 19 cases (21.1%) showed abnormal immunoreactivity for both p16 and p53. (p53+/p16+). There was no correlation of p53 or p16 expression with the clinicopathologic features. The Kaplan-Meier survival analysis demonstrated that patients with p16+, p53+, late stages, and nodal or distal metastasis had poor survival status (P = 0.006, 0.013, <0.001, <0.001 and 0.018, respectively). Further analysis demonstrated that p53 status was a significant prognostic factor in stage I NSCLCs (P < 0.001), and p16 status in stage I and II NSCLCs (P < 0.001, P = 0.003, respectively). Furthermore, patients whose tumors were both p53 and p16 aberrant expression had worse outcome compared with those whose tumors were both normal expression of p53 and p16 (5-year survival rate: 5 vs. 76%, P < 0.001). In Coxs regression model, the aberrant expression of p16, p53, advanced stages and combined aberrant expression of p53/p16 survived for a significant shorter period.nnnCONCLUSIONSnThe results indicated that aberrant expression of p16 and p53 are significant and independent, predictable prognostic factors for resected NSCLC, especially in early stage of NSCLCs. The worst prognosis was seen in patients whose tumors had both aberrant expression of p53 and p16. Further prospective trials may be aimed at confirming and validating these results.

Single nucleotide polymorphisms of the APC gene and colorectal cancer risk: a case-control study in Taiwan.

BackgroundColorectal cancer (CRC), which has become especially prevalent in developed countries, is currently the third highest cause of cancer mortality in Taiwan. Mutation of the adenomatous polyposis coli (APC) gene, a tumour suppressor, is thought to be an early event in colorectal tumourigenesis. To date, however, no large-scale screening for APC gene variants in Chinese subjects has been performed. The present study was undertaken to identify APC gene variants that are significantly associated with the occurrence of CRC in Taiwanese subjects.MethodsIn order to compare the genotype distribution of variant sites, the full-length APC genes of 74 healthy individuals and 80 CRC patients were sequenced.ResultsAmong the 154 Taiwanese subjects examined in this study, three new mutations, but no previously reported mutations, were found. One deletion at codon 460 leading to a frameshift and two missense mutations resulting in p.V1125A and p.S1126R substitutions were identified. Additionally, three high risk genotypes associated with three single nucleotide polymorphisms and one low risk genotype at codon 1822 were identified.ConclusionThe findings of this case-control study are consistent with the proposal that Taiwanese subjects differ from other subjects with respect to phenotypic presentation of APC and CRC risk.

The Extract of Hibiscus syriacus Inducing Apoptosis by Activating p53 and AIF in Human Lung Cancer Cells

Natural products including plants, microorganisms and marine life provide rich resources for anticancer drug discovery. The root bark of Hibiscus syriacus has been used as an antipyretic, anthelmintic and antifungal agent in Asia. The antiproliferative effects of H. syriacus on human lung cancer cells were evaluated with bio-assays. The apoptotic activity was detected by Hoechst 33342 DNA staining and annexin V staining. The expression of caspases, p53, apoptosis induced factor (AIF), Bcl-2 and Bax were evaluated with Western blotting. The in vivo anticancer activity was evaluated using A549-xenograft model. The acetone extract of H. syriacus (HS-AE) exhibited a better cytotoxic effect on lung cancer cells than its methanol extract (HS-ME) or water extract (HS-WE). The IC(50) values of HS-AE on A549 (adenocarcinoma), H209 (squamous cell carcinoma) or H661 (large cell carcinoma) lung cancer cells ranged from 14 to 22 microg/ml after 48 hours of treatment. After 48 hours of exposure, HS-AE (15 microg/ml) induced A549 cell apoptosis to 48 +/- 3.6% of the control. Using Western blotting, HS-AE appears to suppress the expression of p53 and AIF. The results of the in vivo study showed that HS-AE suppresses growth in A549 subcutaneous xenograft tumors. These results indicate that HS-AE exerts significant and dose-dependent antiproliferative effects on cancer cells in vitro and in vivo, which prompts us to further evaluate and elucidate the bioactive component(s) of H. syriacus.

Microsatellite alterations on human chromosome 11 in in situ and invasive breast cancer: A microdissection microsatellite analysis and correlation with p53, ER (estrogen receptor), and PR (progesterone receptor) protein immunoreactivity

Microsatellite instability (MSI) has been documented in a subset of sporadic tumors. Loss of heterozygosity (LOH) on chromosome 11 loci in breast cancer is a frequent event. The purpose of the present study is to examine the incidence of microsatellite alterations in in situ and invasive human breast carcinoma and to clarify their significance in regulating the dynamics of cancer progression.

Prognostic significance of CD44v5 expression in human thymic epithelial neoplasms

BACKGROUNDnCell surface glycoproteins of the CD44 family play roles in cell-cell and cell-matrix interactions. Their aberrant expression has been implicated in tumor invasion and metastasis of a variety of neoplasms, but not, to date, of thymic epithelial tumors.nnnMETHODSnTo investigate the expression of CD44 molecules, immunohistochemical staining using monoclonal antibodies against human CD44 standard form (CD44 s) and two common splicing variant (CD44v) isoforms, CD44v5 and CD44v6, was performed on 64 resected thymomas and 20 normal thymuses. These tumors were categorized histologically according to the World Health Organization (WHO) histologic classification, and the pathologic staging was classified according to the definitions of Masaoka.nnnRESULTSnThe positive expression rates in these patients were as follows: CD44 s (normal thymuses, 10%; thymomas, 22%), CD44v5 (normal thymuses, 0%; thymomas, 67%), and CD44v6 (normal thymuses, 0%; thymomas, 26%). CD44 s and CD44v5 immunoreactivity showed a positive correlation with tumor stages (p = 0.034 and 0.027, respectively). The CD44v5 expression of neoplastic cells in tumor capsules has significant correlation with tumor stages (II, 5%; III, 70%; IVA, 100%; p < 0.001). On the basis of univariate survival analysis, the Masaoka staging system, WHO histologic classification, and CD44v5 expression showed a statistically significant positive relation to survival (p < 0.001, 0.002, 0.011, respectively). Using Coxs regression model, increasing CD44v5 expression, the Masaoka staging, and the WHO classification system were found to be significant independent prognostic factors.nnnCONCLUSIONSnCD44v5 expression is independently positively correlated with the aggressiveness of thymic epithelial tumors. The expression of CD44v5 may be a potential trigger of tumor invasion in thymomas.

Exosomes and Stem Cells in Degenerative Disease Diagnosis and Therapy

Stroke can cause death and disability, resulting in a huge burden on society. Parkinson’s disease (PD) is a chronic neurodegenerative disorder characterized by motor dysfunction. Osteoarthritis (OA) is a progressive degenerative joint disease characterized by cartilage destruction and osteophyte formation in the joints. Stem cell therapy may provide a biological treatment alternative to traditional pharmacological therapy. Mesenchymal stem cells (MSCs) are preferred because of their differentiation ability and possible derivation from many adult tissues. In addition, the paracrine effects of MSCs play crucial anti-inflammatory and immunosuppressive roles in immune cells. Extracellular vesicles (EVs) are vital mediators of cell-to-cell communication. Exosomes contain various molecules such as microRNA (miRNA), which mediates biological functions through gene regulation. Therefore, exosomes carrying miRNA or other molecules can enhance the therapeutic effects of MSC transplantation. MSC-derived exosomes have been investigated in various animal models representing stroke, PD, and OA. Exosomes are a subtype of EVs. This review article focuses on the mechanism and therapeutic potential of MSC-derived exosomes in stroke, PD, and OA in basic and clinical aspects.

Effects of Angelica dahurica and Rheum officinale Extracts on Excisional Wound Healing in Rats

The main objective of wound treatments is to restore the functional skin properties and prevent infection. Traditional Chinese medicine provides alternative anti-inflammatory, antimicrobial, and wound healing therapies. Both Angelica dahurica extract (AE) and Rheum officinale extract (RE) possess antimicrobial activity. In this study, AE and RE were applied in wound treatment to investigate their healing effects. Thirty Sprague-Dawley rats with dorsal full-thickness skin excision were divided into normal saline (NS), AE, RE, AE plus RE (ARE), and Biomycin (BM) groups. The treatment and area measurement of wounds were applied daily for 21 days. Wound biopsies and blood samples were obtained for histology examinations and cytokine analysis. Results showed that wound contraction in ARE group was significantly higher than that in NS and BM groups (P < 0.05). Histological analysis showed that more inflammatory cell infiltration, collagen fibers, and myofibroblasts were observed in ARE treated group than those in NS group on days 3–5. In ARE group, plasma IL-6 levels were elevated during days 3–5 (P > 0.05), and plasma TGF-β1 levels were significantly lower than those in the NS group on days 3-4 (P < 0.05). In conclusion, ARE accelerates wound healing during inflammation and proliferation phases.

Induced Pluripotent Stem Cells: A Powerful Neurodegenerative Disease Modeling Tool for Mechanism Study and Drug Discovery

Many neurodegenerative diseases are progressive, complex diseases without clear mechanisms or effective treatments. To study the mechanisms underlying these diseases and to develop treatment strategies, a reliable in vitro modeling system is critical. Induced pluripotent stem cells (iPSCs) have the ability to self-renew and possess the differentiation potential to become any kind of adult cell; thus, they may serve as a powerful material for disease modeling. Indeed, patient cell-derived iPSCs can differentiate into specific cell lineages that display the appropriate disease phenotypes and vulnerabilities. In this review, we highlight neuronal differentiation methods and the current development of iPSC-based neurodegenerative disease modeling tools for mechanism study and drug screening, with a discussion of the challenges and future inspiration for application.

Advances in Patient-Specific Induced Pluripotent Stem Cells Shed Light on Drug Discovery for Amyotrophic Lateral Sclerosis

Induced pluripotent stem cells (iPSCs), which are generated through reprogramming adult somatic cells by expressing specific transcription factors, can differentiate into derivatives of the three embryonic germ layers and accelerate rapid advances in stem cell research. Neurological diseases such as amyotrophic lateral sclerosis (ALS) have benefited enormously from iPSC technology. This approach can be particularly important for creating iPSCs from patients with familial or sporadic forms of ALS. Motor neurons differentiated from the ALS-patient-derived iPSC can help to determine the relationship between cellular phenotype and genotype. Patient-derived iPSCs facilitate the development of new drugs and/or drug screening for ALS treatment and allow the exploration of the possible mechanism of ALS disease. In this article, we reviewed ALS-patient-specific iPSCs with various genetic mutations, progress in drug development for ALS disease, functional assays showing the differentiation of iPSCs into mature motor neurons, and promising biomarkers in ALS patients for the evaluation of drug candidates.