Claudia Nischwitz

Root-Knot Nematodes in Golf Course Greens of the Western United States

A survey of 238 golf courses in 10 states of the western United States found root-knot nematodes (Meloidogyne spp.) in 60% of the putting greens sampled. Sequence and phylogenetic analyses of 18S rRNA, D2-D3 of 28S rRNA, internal transcribed spacer-rRNA, and mitochondrial DNA gene sequences were used to identify specimens from 110 golf courses. The most common species, Meloidogyne naasi, was found in 58 golf courses distributed from Southern California to Washington in the coastal or cooler areas of those states. In the warmer regions of the Southwest, M. marylandi was recovered from 38 golf courses and M. graminis from 11 golf courses. This constitutes the first report of M. marylandi in Arizona, California, Hawaii, Nevada, and Utah, and the first report of M. graminis in Arizona, Hawaii, and Nevada. Two golf courses in Washington were infested with M. minor, the first record of this nematode in the Western Hemisphere. Columbia root-knot nematode, M. chitwoodi, was found in a single golf course in California. Polymerase chain reaction restriction fragment length polymorphism of the intergenic region between the cytochrome oxidase and 16S rRNA genes in the mitochondrial genome with restriction enzyme SspI was able to distinguish populations of M. graminis from M. marylandi, providing a fast and inexpensive method for future diagnosis of these nematodes from turf.

Phylogeny of the pecan scab fungus Fusicladium effusum G. Winter based on the cytochrome b gene sequence

Pecan scab, caused by the fungus Fusicladium effusum, is the most devastating disease of pecan (Carya illinoinensis) trees and is responsible for the majority of disease management efforts applied to that crop. The taxonomy of the fungus changed several times in the last decade and most recently, using ITS nrDNA data and conventional taxonomic methods, the organism was renamed F. effusum. In our study, a conserved region of the mitochondrial cytochrome b gene was sequenced from three isolates of F. effusum. The obtained sequences showed 95% nucleic acid and 100% amino acid homology (201–266 amino acids on exon 5 of the cytochrome b gene) with Venturia inaequalis (NCBI GenBank accession number AF047029). And in the maximum parsimony tree based on nucleotide sequences, F. effusum and V. inaequalis were clustered, with a 92% bootstrap value. The taxonomic classification of the pecan scab fungus was supported based on the cytochrome b region.

Effect of powdery mildew of pecan shucks on nut weight and quality and relevance to fungicide application

Abstract Powdery mildew of pecan, caused by Microsphaera penicillata (Wallr.:Fr.) Lev., infects pecan shucks but rarely infects other parts of the plant. Although common in orchards in the southeastern United States, it has not been a concern in irrigated pecans in the Southwest until recently. In the past three years, orchards in southern Arizona have been heavily infested. Infections were superficial but caused discoloration of much of the shuck surface. Trials were conducted in 1999 and 2000 to determine if powdery mildew affected nut quality in these orchards by comparing nut weight, kernel weight and kernel color from infected and non-infected fruits. Since powdery mildew infections were ubiquitous throughout the orchards, preventive fungicide applications were made to selected fruits to maintain disease-free shucks as non-infected controls. After harvest, there were no significant differences in whole nut weights, kernel weights, percent fill and kernel color ratings in infected fruits compared to non-infected fruits. Results indicate that powdery mildew infection of pecan shucks does not affect nut weight or kernel quality in irrigated orchards of the Southwest and that control measures for powdery mildew infections are not needed.

Effect of Transplant Age, Tobacco Cultivar, Acibenzolar-S-Methyl, and Imidacloprid on Tomato Spotted Wilt Infection in Flue-Cured Tobacco

Tomato spotted wilt virus (TSWV) has become the most serious problem in flue-cured tobacco in Georgia and is a growing problem in other tobacco-growing areas in the United States. The effects of transplant age (6 to 10 weeks), tobacco cultivar (K-326 and NC-71), and preplant applications of acibenzolar-S-methyl (ASM) and the insecticide imidacloprid (IMD) were evaluated on levels of TSWV infection, number of symptomatic plants, and yield in field trials over 4 years. In all 4 years and in four of five trials, treatment of transplants with ASM and IMD resulted in fewer symptomatic plants, smaller areas under the disease progress curve (AUDPC), and higher yields compared with the nontreated controls. There were no consistent effects of transplant age or cultivar on number of symptomatic plants or systemic infections, AUDPC, or yield. Treatment of transplants with ASM and IMD can significantly reduce the number of symptomatic plants in the field and substantially increase yields and value per hectare.

Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis

ABSTRACT A survey was conducted to evaluate differences in fatty acid methyl ester (FAME) profiles among strains of Pantoea ananatis, causal agent of center rot of onion (Allium cepa), isolated from 15 different onion cultivars in three different sites in Georgia. Differences in FAME composition were determined by plotting principal components (PCs) in two-dimensional plots. Euclidean distance squared (ED(2)) values indicated a high degree of similarity among strains. Plotting of PCs calculated from P. ananatis strains capable of growing on media amended with copper sulfate pentahydrate (200 mug/ml) indicated that copper-tolerant strains grouped into tight clusters separate from clusters formed by wild-type strains. However, unlike copper-sensitive strains, the copper-tolerant strains tended to cluster by location. A total of 80, 60, and 73% of the strains from Tift1, Tift2, and Tattnall, respectively, exhibited either confluent growth or partial growth on copper-amended medium. However, all strains were sensitive to a mixture of copper sulfate pentahydrate (200 mug/ml) and maneb (40 mug/ml). When copper-tolerant clones were analyzed and compared with their wild-type parents, in all cases the plotting of PCs developed from copper-tolerant clones formed tight clusters separate from clusters formed by the parents. Eigenvalues generated from these tests indicated that two components provided a good summary of the data, accounting for 98, 98, and 96% of the standardized variance for strains Pna 1-15B, Pna 1-12B, and Pna 2-5A, respectively. Furthermore, feature 4 (cis-9-hexadecenoic acid/2-hydroxy-13-methyltetradecanoic acid) and feature 7 (cis-9/trans-12/cis-7-octadecenoic acid) were the highest or second highest absolute values for PC1 in all three strains of the parents versus copper-tolerant clones, and hexadecanoic acid was the highest absolute value for PC2 in all three strains. Along with those fatty acids, dodecanoic acid and feature 3 (3-hydroxytetradecanoic acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on Kings medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Geographical Distribution and Survival of Iris yellow spot virus in Spiny Sowthistle, Sonchus asper, in Georgia

Iris yellow spot virus (IYSV) has occurred in Georgia since 2003. IYSV is transmitted by onion thrips, Thrips tabaci. During a weed survey in the Vidalia onion-growing zone (VOZ), spiny sowthistle (Sonchus asper) was identified as a host for IYSV. Spiny sowthistle is widespread in Georgia, and this presented an opportunity to study the natural spread of IYSV and assess its potential role in IYSV epidemiology. From 2007 to 2009, during the spring season, 2,011 sowthistle samples were collected from various counties within and outside the VOZ. The samples were tested for IYSV infection by enzyme-linked immunosorbent assay and confirmed by reverse-transcription polymerase chain reaction and sequencing. IYSV sequences from sowthistle were 98 to 99% identical to onion IYSV sequences from onion originated from Georgia. By the third year, IYSV-infected sowthistle plants were found in 79% of the counties in the VOZ and in 61% of the sampled counties in all directions, except to the east of the VOZ. Furthermore, thrips-mediated transmission assays confirmed that T. tabaci can efficiently transmit IYSV from onion to sowthistle. Sowthistle also supported T. tabaci survival and reproduction. These findings demonstrate that sowthistle plants can serve as an IYSV inoculum source and as a thrips reservoir.

First report of powdery mildew (Sawadaea bicornis) on Norway maple (Acer platanoides) in North America.

Norway maple (Acer platanoides L.) was introduced into the continental United States around 1756 as a street tree (2). It is a widely planted shade tree in the northern United States and Canada due to its fast growth rate when young and its tolerance of pavement and dry soils. Powdery mildew is common on Norway maple in Europe with records from at least 22 countries according to the databases of the U.S. National Fungus Collections. However, there are no North American records. In September 2002, powdery mildew was observed on young Norway maple trees along the Idaho-Washington border in Moscow and Pullman, respectively. Mildew was not observed on older Norway maple trees. The mildew occurred mainly on the upper leaf surface as patches of dense, white mycelium with scattered or gregarious cleistothecia. Mean diameter of the cleistothecia was 146 (± 13.4) μm. Short stalked and subsessile asci averaged 69 (± 4.1) μm × 48 (± 5.4) μm. Ascospores averaged 27 (± 3.2) μm × 12 (±0.9) μm. Appendages were deeply cleft, simple, or one to three times dichotomously branched. This mildew fits the description of the European species Sawadaea bicornis (Wallr:Fr.) Homma (1). Also, conforming to S. bicornis were chains of macroconidia (21 (± 2.7) × 14 (± 1.5) μm) and microconida. Fibrosin bodies were seen in both. Infection of only some young trees and its absence in previous years lead us to believe that the introduction is recent in the Pacific Northwest. The susceptibility of native maples to the Norway maple mildew remains to be determined. Specimens have been deposited in the U.S. National Fungus Collections (BPI 842088). References: (1) U. Braun. A monograph of the Erysiphales (powdery mildews) J. Cramer, Berlin-Stuttgart, 1987. (2) D. J. Nowak and R. A. Rowntree. J. Arboric. 16:291, 1990.

First Report of Powdery Mildew (Microsphaera palczewskii) on Siberian Pea Tree (Caragana arborescens) in North America

Caragana arborescens Lam. is an exotic ornamental that can also be somewhat invasive. In July 2002, powdery mildew was observed on C. arborescens along the Idaho-Washington border in Moscow and Pullman, respectively. Leaves were colonized as soon as they emerged, and entire plants were affected. The fungus covered both leaf surfaces, but cleistothecia were more abundant on abaxial surfaces. The mean diameter of the cleistothecia was 91 (± 9.8) μm. Short-stalked asci averaged 67 (± 7.1) μm × 37 (± 5.2) μm, and the ascospores were 21 (± 2.0) μm × 13 (± 0.8) μm. There are records of four species of Microsphaera on C. arborescens in Europe and Asia. The measurements fit the description of Microsphaera palczewskii Jacz. (1), and the identification was confirmed by comparison with specimens of this fungus on C. arborescens from Sweden (U.S. National Fungus Collections: BPI 749057 and 749058). Specimens of M. grossulariae (Wallr. ex Fr.) Lev. on Ribes divaricatum Dougl. from California (BPI 558266) were also examined, but the cleistothecial appendages were distinctly different from those of the Idaho specimens. To our knowledge, this is the first reported occurrence in North America of powdery mildew on C. arborescens and the first report of M. palczewskii. The latter may have been introduced recently into North America because there are areas in southern Canada and the northern United States in which C. arborescens is unaffected by powdery mildew. Interestingly, it is only in recent decades that M. palczewskii has spread from Asia into Europe (2). Now, host and parasite have been reunited in North America as well. Specimens have been deposited in the U.S. National Fungus Collections (BPI). References: (1) U. Braun. A monograph of the Erysiphales (powdery mildews) J. Cramer, Berlin-Stuttgarg, 1987. (2) S. Huhtinen et al. Karstenia 41:31, 2001.

First Report of Powdery Mildew Caused by Erysiphe cichoracearum on Creeping Thistle (Cirsium arvense) in North America

Creeping or Canada thistle (Cirsium arvense (L.) Scop.) is a perennial weed of Eurasian origin that arrived in North America as early as the 1700s (3). Spreading by seeds and rhizomes, it is now widely distributed in Canada, Alaska, and 40 other states. It is apparently absent from Texas, Oklahoma, Louisiana, Mississippi, Alabama, Georgia, Florida, and South Carolina (1). Powdery mildew is common on C. arvense in Europe, but it has never been observed in North America (4). In Europe and Asia, powdery mildew of C. arvense is caused by any one of the following fungi: Leveillula taurica, two species of Sphaerotheca, and varieties of Erysiphe cichoracearum and E. mayorii. Specimens of C. arvense infected with powdery mildew (deposited in the U.S. National Fungus Collections as BPI 843471) were collected in the fall of 2003 near Moscow, ID and in two areas in Oregon (the canyon of the Grande Ronde River and near the base of the Wallowa Mountains). Mycelium and cleistothecia were observed on stems and upper and lower surfaces of leaves. The mean diameter of the cleistothecia was 122 (±11.6) μm. Basally inserted, mycelioid appendages were hyaline or brown and varied considerably in length, but most were in the range of 80 to 120 μm. Asci averaged 58 (±5.5) μm × 35 (±4.1) μm in length and width, respectively. Each ascus bore two ascospores averaging 23 (±1.4) μm × 14 (±1.7) μm. Conidia averaged 30 (±3.0) μm × 14 (±0.8) μm. The specimens fit the description of E. cichoracearum DC. (2). Because the length/breadth ratio of conidia is greater than 2, the specimens could be further diagnosed as E. cichoracearum var. cichoracearum (2). Also noteworthy was the presence of the hyperparasitic Ampelomyces quisqualis Ces. ex Schlechtend. E. cichoracearum is thought to be a cosmopolitan powdery mildew of broad host range, but this concept is difficult to reconcile with the absence of mildew on North American populations of C. arvense for more than 200 years. References: (1) Anonymous. USDA Natural Resources Conservation Service Plants Profile for Cirsium arvense. On-line publication, 2003. (2) U. Braun. A monograph of the Erysiphales (powdery mildews), J. Cramer, Berlin-Stuttgart, 1987. (3) G. Cox. Alien Species in North America and Hawaii, Island Press, Washington, D.C., 1999. (4) D. F. Farr et al. Fungal Databases, Systematic Botany and Mycology Laboratory, ARS, USDA. On-line publication, 2003.