S. W. Mullis

First report of Vidalia onion (Allium cepa) naturally infected with tomato spotted wilt virus and Iris yellow spot virus (family Bunyaviridae, genus Tospovirus) in Georgia.

Vidalia onion is an important crop in Georgias agriculture with worldwide recognition as a specialty vegetable. Vidalia onions are shortday, Granex-type sweet onions grown within a specific area of southeastern Georgia. Tomato spotted wilt virus (TSWV) has been endemic to Georgia crops for the past decade, but has gone undetected in Vidalia onions. Tobacco thrips (Frankliniella fusca) and Western flower thrips (Frankliniella occidentalis) are the primary vectors for TSWV in this region, and a number of plant species serve as reproductive reservoirs for the vector or virus. Iris yellow spot virus (IYSV), an emerging tospovirus that is potentially a devastating pathogen of onion, has been reported in many locations in the western United States (2,4). Thrips tabaci is the known vector for IYSV, but it is unknown if noncrop plants play a role in its epidemiology in Georgia. During October 2003, a small (n = 12) sampling of onions with chlorosis and dieback of unknown etiology from the Vidalia region was screened for a variety of viruses, and TSWV and IYSV infections were serologically detected. Since that time, leaf and bulb tissues from 4,424 onion samples were screened for TSWV and IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) with commercial kits (Agdia Inc., Elkhart, IN). Samples were collected from 53 locations in the Vidalia region during the growing season between November 2003 and March 2004. Plants exhibiting stress, such as tip dieback, necrotic lesions, chlorosis or environmental damage were selected. Of these, 306 were positive for TSWV and 396 were positive for IYSV using positive threshold absorbance of three times the average plus two standard deviations of healthy negative onion controls. Positive serological findings of the onion tissues were verified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) for TSWV (3) and RT-PCR for IYSV (1). In both instances, a region of the viral nucleocapsid (N) gene was amplified. The PCR products were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose. Eighty-six percent (n = 263) of the TSWV ELISA-positive samples exhibited the expected 774-bp product and 55 percent (n = 217) of the IYSV ELISA-positive samples exhibited the expected 962-bp product. The reduced success of the IYSV verification could be attributed to the age and deteriorated condition of the samples at the time of amplification. Thrips tabaci were obtained from onion seedbeds and cull piles within the early sampling (n = 84) and screened for TSWV by the use of an indirect-ELISA to the nonstructural (NSs) protein of TSWV. Of the thrips sampled, 25 were positive in ELISA. While the incidence of IYSV and TSWV in the Vidalia onion crop has been documented, more research is needed to illuminate their potential danger to Vidalia onions. References: (1) I. Cortês et al. Phytopathology 88:1276, 1998. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) R. K. Jain et al. Plant Dis. 82:900, 1998. (4) J. W. Moyer et al. (Abstr.) Phytopathology 93(suppl.):S115, 2003.

Effect of Transplant Age, Tobacco Cultivar, Acibenzolar-S-Methyl, and Imidacloprid on Tomato Spotted Wilt Infection in Flue-Cured Tobacco

Tomato spotted wilt virus (TSWV) has become the most serious problem in flue-cured tobacco in Georgia and is a growing problem in other tobacco-growing areas in the United States. The effects of transplant age (6 to 10 weeks), tobacco cultivar (K-326 and NC-71), and preplant applications of acibenzolar-S-methyl (ASM) and the insecticide imidacloprid (IMD) were evaluated on levels of TSWV infection, number of symptomatic plants, and yield in field trials over 4 years. In all 4 years and in four of five trials, treatment of transplants with ASM and IMD resulted in fewer symptomatic plants, smaller areas under the disease progress curve (AUDPC), and higher yields compared with the nontreated controls. There were no consistent effects of transplant age or cultivar on number of symptomatic plants or systemic infections, AUDPC, or yield. Treatment of transplants with ASM and IMD can significantly reduce the number of symptomatic plants in the field and substantially increase yields and value per hectare.

First Report of a New Disease of Onion in Georgia Caused by a Nonfluorescent Pseudomonas Species

Since 2007, a new disease of onion (Allium cepa) called yellow bud has been a problem in Georgia. Emerging leaves display intense chlorosis and older leaves exhibit extensive leaf blight. Yield reductions can be severe due to stand loss and reduced bulb size. Symptomatic plants are also more prone to freeze damage. The suspected causal agent is a slow-growing, white bacterium isolated onto nutrient agar (NA) by streak isolation. The bacterium grew more vigorously on NA supplemented with 0.5% yeast extract (NA+). Six strains of the bacterium all had gram-negative, rod-shaped cells and were strict aerobes. The strains produced levan, were negative for oxidase, potato rot, and arginine dihydrolase, and produced a hypersensitive reaction in tobacco. These are all characteristics of Pseudomonas group Ia as outlined by Lelliott et al. (2) and differ from characteristics of known Pseudomonas pathogens of onion such as P. aeruginosa, P. marginalis, and P. viridiflava that belong to groups Va, IVa, and II, respectively. The yellow bud bacterial strains were also nonfluorescent on Kings medium B and were ice nucleation active. Universal primers PA16SF and PA16SR (ATCCTGGCTCAGATTGAACG and TTCCCCTACGGTTACCTTGTT) were used to amplify the 16S rRNA gene. The resulting consensus nucleotide sequence (GenBank Accession No. JF939841) of the six isolates matched those strains of P. syringae pv. atropurpurea, P. syringae pv. maculicola, P. syringae pv. porri, and P. amygdali (96 to 98% similarity). Primers 1 and 2 (GGCGCTCCCTCGCACTT and GGTATTGGCGGGGGTGC) were used to amplify the coronafacate ligase (cfl) gene. The resulting consensus nucleotide sequence for the six isolates (GenBank Accession No. JF939842) matched the cfl gene from P. syringae pv. tomato, P. syringae pv. morsprunorum, P. syrinage pv. aesculi, and P. syringae pv. glycinea (97 to 99% similarity). Representative strains had 0.95 to 0.99% similarity to P. syringae pv. coronafaciens using Biolog (Biolog, Hayward, CA), and 0.72 to 0.96% similarity to P. syringaepv. tomato using fatty acid analysis (MIDI Inc., Newark, DE). For each of eight representative yellow bud strains, 10 greenhouse-grown onion seedlings of cv. Pegasus were inoculated on one leaf. Bacteria grown on NA+ were suspended in sterile tap water and adjusted to ~1 × 108 CFU/ml. With a hypodermic syringe and needle, 1.0 ml of inoculum was injected in to the hollow cavity of an emerging onion leaf. Chlorosis developed on inoculated leaves in 5 days and was identical to that observed with natural infections. All inoculated plants died within 14 days, confirming pathogenicity. Bacteria with characteristics described above were reisolated from symptomatic leaves. Ten control plants inoculated with sterile water remained asymptomatic. Based on the methods listed above, the yellow bud bacterium was identified as P. syringae, but pathovar designation or genomospecies (1) could not be determined because results varied among the different methods tested. The disease has been spreading throughout the Vidalia onion-growing region since it was first observed. There is significant potential for the disease to become more widespread since it also has been observed in direct-seeded, onion transplant beds. References: (1) J. P. Euzéby. List of Prokaryotic Names with Standing in Nomenclature-Genus Pseudomonas. Online publication. Retrieved from http://www.bacterio.cict.fr/p/pseudomonas.html , 2010. (2) R. A. Lelliott et al. J. Appl. Bact. 29:470, 1966.

Geographical Distribution and Survival of Iris yellow spot virus in Spiny Sowthistle, Sonchus asper, in Georgia

Iris yellow spot virus (IYSV) has occurred in Georgia since 2003. IYSV is transmitted by onion thrips, Thrips tabaci. During a weed survey in the Vidalia onion-growing zone (VOZ), spiny sowthistle (Sonchus asper) was identified as a host for IYSV. Spiny sowthistle is widespread in Georgia, and this presented an opportunity to study the natural spread of IYSV and assess its potential role in IYSV epidemiology. From 2007 to 2009, during the spring season, 2,011 sowthistle samples were collected from various counties within and outside the VOZ. The samples were tested for IYSV infection by enzyme-linked immunosorbent assay and confirmed by reverse-transcription polymerase chain reaction and sequencing. IYSV sequences from sowthistle were 98 to 99% identical to onion IYSV sequences from onion originated from Georgia. By the third year, IYSV-infected sowthistle plants were found in 79% of the counties in the VOZ and in 61% of the sampled counties in all directions, except to the east of the VOZ. Furthermore, thrips-mediated transmission assays confirmed that T. tabaci can efficiently transmit IYSV from onion to sowthistle. Sowthistle also supported T. tabaci survival and reproduction. These findings demonstrate that sowthistle plants can serve as an IYSV inoculum source and as a thrips reservoir.