Dan A. Wiginton

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Biochemical and Functional Abnormalities in Lymphocytes from an Adenosine Deaminase-deficient Patient during Enzyme Replacement Therapy

Biochemical and immunological properties of lymphocytes were measured repetitively over a period of 40 mo during enzyme replacement by transfusion in a child with adenosine deaminase (ADA) deficiency and severe combined immunodeficiency disease. Catalytically defective ADA protein is present in the childs cells. ADA activity in his lymphocytes is 7 nmol/min per 10(8) cells with 51 ng of ADA protein/10(8) cells by radioimmunoassay. ADA activities in normal cord and adult lymphocytes average 193 and 92 nmol/min per 10(8) cells, respectively, with 429 and 223 ng of ADA protein/10(8) cells. Deoxy(d)ATP accumulates in the patients erythrocytes and lymphocytes. Transfusion of irradiated packed erythrocytes partially corrects the metabolic defects. Frank metabolic relapse occurs if transfusions are discontinued for several months. The amounts of dATP in erythrocytes and lymphocytes averaged 13 and 2 times normal, respectively, during periods when transfusions were administered every 2-4 wk. Deoxyguanosine triphosphate and deoxycytidine triphosphate in lymphocytes were normal on 11 occasions, but deoxyribosylthymine triphosphate was ninefold increased. On 11 occasions dATP was measured in lymphocytes and erythrocytes isolated simultaneously. There was a positive, but statistically insignificant, correlation between amounts of dATP in the two types of cells (r = 0.25,P > 0.1). The absolute peripheral lymphocyte count was correlated with the activity of ADA in circulating erythrocytes and with the response of lymphocytes to phytohemagglutinin (r = 0.64, P < 0.01; r = 0.49, P < 0.05). Response of lymphocytes to stimulation by phytohemagglutinin in vitro and absolute peripheral lymphocyte counts were not significantly correlated with levels of dATP in the erythrocyte or lymphocyte during periods of intensive therapy. Although there was objective improvement during enzyme replacement, the child remained immunodeficient and biochemically abnormal.

PDX-1 is required for activation in vivo from a duodenum-specific enhancer

The purine metabolic gene adenosine deaminase (ADA) is expressed along a defined spatiotemporal pattern in the developing mammalian small intestine, where high-level expression is limited to the villous epithelium of the duodenum. This activation is observed in rodents as the intestine completes the final maturation resulting in adult crypt-villus structures at 2–3 weeks postpartum. A regulatory module responsible for this pattern of expression has been identified in the second intron of the human ADA gene. Of the multiple duodenal proteins that can interact with this small duodenal enhancer region, the studies contained in this work describe the identification of five of these proteins as the dispersed homeobox protein PDX-1. This transcription factor exhibits a profile of expression in the small intestine similar to that observed for ADA, making it an ideal candidate factor for the duodenum-specific ADA enhancer. Loss of PDX-1 binding, via a PDX-1 mutated enhancer transgenic construction, resulted in complete loss of high-level activation in the duodenum, demonstrating the absolute requirement for this factor in vivo. However, co-transfection experiments suggest that other proteins that bind the enhancer are also required for enhancer function because PDX-1 alone was incapable of significant transactivation.

GENOMIC SEQUENCE COMPARISON OF THE HUMAN AND MOUSE ADENOSINE DEAMINASE GENE REGIONS

Abstract. A challenge for mammalian genetics is the recognition of critical regulatory regions in primary gene sequence. One approach to this problem is to compare sequences from genes exhibiting highly conserved expression patterns in disparate organisms. Previous transgenic and transfection analyses defined conserved regulatory domains in the mouse and human adenosine deaminase (ADA) genes. We have thus attempted to identify regions with comparable similarity levels potentially indicative of critical ADA regulatory regions. On the basis of aligned regions of the mouse and human ADA gene, using a 24-bp window, we find that similarity overall (67.7%) and throughout the noncoding sequences (67.1%) is markedly lower than that of the coding regions (81%). This low overall similarity facilitated recognition of more highly conserved regions. In addition to the highly conserved exons, ten noncoding regions >100 bp in length displayed >70% sequence similarity. Most of these contained numerous 24-bp windows with much higher levels of similarity. A number of these regions, including the promoter and the thymic enhancer, were more similar than several exons. A third block, located near the thymic enhancer but just outside of a minimally defined locus control region, exhibited stronger similarity than the promoter or thymic enhancer. In contrast, only fragmentary similarity was exhibited in a region that harbors a strong duodenal enhancer in the human gene. These studies show that comparative sequence analysis can be a powerful tool for identifying conserved regulatory domains, but that some conserved sequences may not be detected by certain functional analyses as transgenic mice.

Regulation of Duodenal Specific Expression of the Human Adenosine Deaminase Gene

Formation of the mammalian gastrointestinal tract is an ordered process of development and differentiation. Yet, the adult small intestine also retains the plasticity to respond to cues both internal and environmental to modulate intestinal function. The components that regulate this development, differentiation, and modulation at the molecular level are only now being elucidated. We have used the human adenosine deaminase (ADA) gene as a model to identify potential cis-regulatory components involved in these processes within the small intestine. In mammals, high levels of ADA in the small intestine are limited specifically to the differentiated enterocytes within the duodenal region. These studies describe the identification of a region of the human ADA gene, completely distinct from the previously identified T-cell enhancer, which is capable of directing the human intestinal expression pattern in the intestine of transgenic mice. The reporter gene expression pattern observed in these transgenic mice is identical to the endogenous gene along both the cephalocaudal and crypt/villus axis of development. Timing of this transgene activation, however, varies from that of the endogenous mouse gene in that the transgene is activated approximately 2 weeks earlier in development. Even so, this precocious activation is also limited to the epithelium of the developing villi strictly within the duodenal region of the small intestine.

Identification of a murine homolog of the human adenosine deaminase thymic enhancer

We have identified a 236-bp first intron segment of the mouse adenosine deaminase gene (ADA) that shares 71.1% identity with the human ADA thymic enhancer. This segment has the same natural orientation as the human enhancer and a relative location within the first intron very analogous to that of the human enhancer. Four highly conserved regions were defined within this segment, including a 72-bp region having 83.6% identity with a segment containing the critical human enhancer core. Several consensus binding sequences were also conserved within these regions. Transient transfection assays in human and murine T-cell lines revealed that a 1.8-kb murine genomic fragment harboring the 236-bp segment functions as a weak activator of both the human and mouse ADA promoters. In contrast, a 2.3-kb human enhancer fragment exhibited high-level activation in conjunction with either the human or mouse ADA promoter in both the MOLT 4 (human) and S49 (murine) T-cell lines. Interestingly, the murine ADA promoter is significantly stronger than the human promoter in driving cat expression in transient transfection assays in all the T-cell lines tested.

Onecut-2 knockout mice fail to thrive during early postnatal period and have altered patterns of gene expression in small intestine

Ablation of the mouse genes for Onecut-2 and Onecut-3 was reported previously, but characterization of the resulting knockout mice was focused on in utero development, principally embryonic development of liver and pancreas. Here we examined postnatal development of these Onecut knockout mice, especially the critical period before weaning. Onecut-3 knockout mice develop normally during this period. However, Onecut-2 knockout mice fail to thrive, lagging behind their littermates in size and weight. By postnatal day (d)19, they are consistently 25-30% smaller. Onecut-2 knockout mice also have a much higher level of mortality before weaning, with only approximately 70% survival. Interestingly, Onecut-2 knockout mice that are heterozygous for the Onecut-3 knockout allele are diminished even further in their ability to thrive. They are approximately 50-60% as large as their normal-sized littermates at d19, and less than half of these mice survive to weaning. As reported previously, the Onecut-2/Onecut-3 double knockout is a perinatal lethal. Microarray technology was used to determine the effect of Onecut-2 ablation on gene expression in duodenum, whose epithelium has among the highest levels of Onecut-2. A subset of intestinally expressed genes showed dramatically altered patterns of expression. Many of these genes encode proteins associated with the epithelial membrane, including many involved in transport and metabolism. Previously, we reported that Onecut-2 was critical to temporal regulation of the adenosine deaminase gene in duodenum. Many of the genes with altered patterns of expression in Onecut-2 knockout mouse duodenum displayed changes in the timing of gene expression.

Characterization of normal and mutant adenosine deaminase messenger RNAs by translation and hybridization to a cDNA probe

SummaryUsing both in vitro translation and hybridization to an adenosine deaminase (ADA) cDNA probe, ADA mRNA has been characterized in B lymphoblast lines established from seven ADA-deficient children, two parents of an ADA-deficient child, and three normal people. All ADA-deficient lines except GM-2825A, including those with less than 1% of normal catalytic activity, had normal or greater amounts of hybridizable, 1.6 kilobase in size, ADA mRNA. Immunoreactive ADA protein of normal size was produced by in vitro translation of the mRNAs. Deficiency of ADA activity in these lines appears secondary to synthesis of structurally altered proteins rather than to a quantitative deficiency in ADA mRNA. The GM-2825A line contains electrophoretically abnormal species of RNA which hybridize to the cDNA probe. Deficiency of ADA activity in this line appears at least in part secondary to a structural defect in the ADA mRNA or its precursors.

Cdx Binding Determines the Timing of Enhancer Activation in Postnatal Duodenum

In mammalian intestine, adenosine deaminase (ADA) is expressed at high levels only along the villi of the duodenal epithelium. A duodenum-specific enhancer identified in the second intron of the human ADA gene controls this pattern of expression. This enhancer faithfully recapitulates this expression pattern in transgenic mice, when included in CAT reporter gene constructions. Multiple binding sites for PDX-1 and GATA factors were previously identified within the ∼300-bp region that encompasses the enhancer. Mutation analyses demonstrated that binding of PDX-1 and of GATA-4 was absolutely essential for enhancer function. In the present study, we have identified additional enhancer binding sites for Cdx factors, for YY1, and for NFI family members. Detailed EMSA studies were used to confirm binding at these sites. This brings the number of confirmed binding sites within the enhancer to thirteen, with five different factors or family of factors contributing to the putative enhanceosome complex. Mutation analysis was utilized to examine the specific roles of the newly identified sites. Two sites were identified that bound both Cdx1 and Cdx2. Mutations were identified in these two sites that completely and specifically eliminated Cdx binding. In transgenic mice, these enhancer mutations dramatically changed the developmental timing of enhancer activation (delaying it by 2–3 weeks) without affecting other aspects of enhancer function. In the chromatin context of certain transgenic insertion sites, mutation of the two YY1 sites to specifically ablate binding caused a delay in enhancer activation similar to that observed with the Cdx mutations. No overt changes were observed from mutation of the NFI site.

Temporal Regulation of Enhancer Function in Intestinal Epithelium A ROLE FOR ONECUT FACTORS

An intestine-specific gene regulatory region was previously identified near the second exon of the human adenosine deaminase (ADA) gene. In mammalian intestine, ADA is expressed at high levels only along the villi of the duodenal epithelium, principally if not exclusively in enterocytes. Within the ADA intestinal regulatory region, a potent duodenum-specific enhancer was identified that controls this pattern of expression. This enhancer has been shown to rely on PDX-1, GATA factors, and Cdx factors for its function. Upstream of the enhancer, a separate temporal regulatory region was identified that has no independent enhancer capability but controls the timing of enhancer activation. DNase I footprinting and electrophoretic mobility shift assays were used to begin to characterize temporal region function at the molecular level. In this manner, binding sites for the Onecut (OC) family of factors, YY1, and NFI family members were identified. Identification of the OC site was especially interesting, because almost nothing is known about the function of OC factors in intestine. In transgenic mice, mutation of the OC site to ablate binding resulted in a delay of 2–3 weeks in enhancer activation in the developing postnatal intestine, a result very similar to that observed previously when the entire temporal region was deleted. In mammals, the OC family is comprised of OC-1/HNF-6, OC-2, and OC-3. An examination of intestinal expression patterns showed that all three OC factors are expressed at detectable levels in adult mouse duodenum, with OC-2 predominant. In postnatal day 2 mice only OC-2 and OC-3 were detected in intestine, with OC-2 again predominant.