John J. Hutton

A rapid assay for collagen proline hydroxylase

Abstract A method for the assay of collagen proline hydroxylase is presented. Hydroxyproline-deficient protein, which serves as substrate, is prepared by incubating minces of chick embryo with 3,4-T- l -proline in the presence of α,α′-dipyridyl. Following extraction and partial purification, the substrate is incubated with proline hydroxylase, which converts some of the 3,4-T- l -proline residues to 3-T- l -hydroxyproline. The tritium atom which is released from carbon 4 equilibrates with water and the resulting tritiated water is assayed following vacuum distillation. It was shown that tritiated water release is entirely dependent on enzymic hydroxylation and that equivalent amounts of 3-T- l -hydroxyproline and tritiated water are formed. This method is much more rapid and accurate than previously described methods.

Cofactor and substrate requirements of collagen proline hydroxylase

Abstract Enzyme fractions which catalyze the hydroxylation of peptidyl-proline to form peptidyl-hydroxyproline have been prepared from chick embryo, guinea-pig granuloma and fetal rat skin. In all preparations ferrous ion, ascorbic acid, α-ketoglutarate and molecular oxygen are required for activity. No compounds have been found which can replace ferrous ion and α-ketoglutarate. Reduced pteridines can partially replace ascorbic acid, but reduced pyridine nucleotides are inactive. The enzyme has been called collagen proline hydroxylase and has been tentatively classified as a mixed-function oxidase. A formulation of the reaction catalyzed by this enzyme has been proposed in which ascorbate functions as a reducing agent and α-ketoglutarate as a modifier of the enzyme.

Overproduction of adenine deoxynucleosides and deoxynucletides in adenosine deaminase deficiency with severe combined immunodeficiency disease.

The deoxynucleotide, dATP, is elevated 50- to 1,000-fold above normal in erythrocytes, lymphocytes, and bone marrow from a child with adenosine deaminase deficiency and severe combined immunodeficiency disease. The child, when 17 mo of age, was also excreting approximately 30 mg of deoxyadenosine per day in urine (normal is less than 0.1 mg/day). Urinary excretion of uric acid was decreased. Elevated dATP levels in lymphocytes and bone marrow, and increased urinary excretion of deoxyadenosine, persisted despite hypertransfusion of the child with irradiated erythrocytes from a donor with normal adenosine deaminase. Overproduction of deoxynucleotides by increased salvage of adenosine appears to be the primary metabolic abnormality in patients with adenosine de aminase deficiency.

The genetics of aryl hydrocarbon hydroxylase induction in mice: a single gene difference between C57BL-6J and DBA-2J.

Twenty-one inbred strains of mice were surveyed for inducibility of hepatic aryl hydrocarbon hydroxylase (AHH) activity by the carcinogen 3-methylcholanthrene (MC). In 11 strains given MC, AHH activity increased 1.3- to 5-fold (inducible), whereas ten strains responded with a less than 0.5-fold increase (noninducible). Neither the inducible nor the noninducible class was homogeneous, and in each considerable variation was found in both the basal activity of AHH and the response to MC. Strains DBA/2J and C57BL/6J were chosen to represent the noninducible and inducible classes, respectively. In the crosses (C57BL/6 × DBA/2)F1 × DBA/2 and (C57BL/6 × DBA/2)F2, inducibility segregated as a single autosomal dominant gene. The gene symbols Ahhi and Ahhn are proposed for the alleles present in C57BL/6J and DBA/2J, respectively. No genetic linkage was found between the Ahh locus and the following loci: b, d, Es-1, Es-3, Gpd-1, Hbb, Id-1, Pgm-1, and sex. Some implications of this work in the study of mammalian enzyme induction and chemically induced carcinogenesis are discussed. There is a positive correlation between AHH inducibility and the development of an inflammatory response to the topical application of the carcinogen 7,12-dimethylbenzanthracene.

Collagen Proline Hydroxylase in Wound Healing, Granuloma Formation, Scurvy, and Growth

Compared to homologous tissues from adult animals, rapidly growing embryonic and fetal tissues contain large amounts of collagen proline hydroxylase. Lung and skin from scorbutic guinea pigs contain one-third as much enzyme as normal tissues do. A rapid increase in proline hydroxylase occurs on the 2nd day of formation of granuloma after injection of carrageenan and on the 4th day of wound healing. The increase in enzyme activity is associated with the onset of collagen biosynthesis and deposition.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Linkage analyses using biochemical variants in mice. III. Linkage relationships of eleven biochemical markers.

The linkage relationships of 11 loci concerned with protein or enzyme variation in the inbred mouse (Mus musculus) have been investigated. By means of a three-point cross, the order of the loci glucosephosphate isomerase (Gpi-1), albino (c), and hemoglobin β-chain in linkage group I has been established as Gpi-c-Hbb. Similarly, the order of the loci autosomal glucose 6-phosphate dehydrogenase (Gpd-1), misty (m), and brown (b) in linkage group VIII has been established as Gpd-m-b. The levulinate dehydratase locus (Lv) in linkage group VIII which shows 5±2% recombination with the brown locus is near the anemia locus (an). The locus for malic dehydrogenase (Mdh-1) shows 10.1±2.9% recombination with the dilute locus and 12.0±6.5% recombination with the luxoid locus. The tentative order of the three loci is d-Mdh-1-lu. Recombination between the isocitric dehydrogenase locus (Id-1) and the leaden locus (ln) is 16.7±5.8% and between Id-1 and the splotch locus (Sp) is 11.0±5.4% in linkage group XIII. The tentative order of the three loci is ln-Sp-Id-1. Recombination between the lactic dehydrogenase regulatory locus (Ldr-1) and the microphthalmia locus (Miwh) in linkage group XI is 28.7±4.4%. Recombination between the phosphoglucomutase locus (Pgm-1) and the W-locus in linkage group XVII is 3.0±1.7%. The esterase-3 locus has not been placed in a linkage group and has been tested against markers on linkage groups I, II, III, IV, V, VI, VIII, XI, XII, XIII, XVI, XVII, XVIII, and XX. In no case was there physical linkage of structural genes whose products participate in related metabolic pathways.

Genetic linkage relationships of loci specifying differentiation alloantigens in the mouse.

Data concerning the linkage relationships of loci determining cell surface differentiation alloantigens in the mouse are reported. The order of the loci theta antigen (&thetas;), dilute (d), and malic enzyme (Mod-1) in genetic linkage group (LG) II is &thetas;-d-Mod-1. Recombination between &thetas; and d is 15.0 \Pm 4.0%. The lymphocyte antigen C locus (Ly-C) and the lymphocyte antigen B locus (Ly-B) are closely linked; no recombinants were observed among 370 backcross segregants. The provisional symbols, Ly-A and Ly-B,C, therefore, provide a useful descriptive notation for the loci of the Ly series so far recognized. Recombination between the lactic dehydrogenase regulatory locus (Ldr-1) and the Ly-B,C locus is 37.5 \Pm 5.4% and between Ly-B,C and the microphthalmia locus (mi), 7.3 \Pm 2.2% in linkage group XI. The tentative order of the three loci is Ly-B,C-mi-Ldr-1. Other (negative) linkage data, involving biochemical, serological, and other markers, are summarized.

Terminal deoxynucleotidyltransferase distribution in neoplastic and hematopoietic cells.

In the present study, terminal deoxynucleotidyltransferase was examined in the peripheral blood and (or) bone marrow of 115 children with a variety of neoplastic, hematologic, and other unrelated disorders. Terminal deoxynucleotidyltransferase activity was present at 4.08+/-0.74 U/108 cells in 23 morphologicall normal bone marrow samples from childhood controls. Terminal transferase was present at greater than 23 U/108 nucleated cells and at greater than31 U/108 blasts in the bone marrow of all children with acute lymphoblastic leukemia studied at initial diagnosis and at disease relapse. Terminal deoxynucleotidyltransferase was detectable at low levels, less than 7.5 U/108 cells, in all remission marrow smaples. Bone marrow terminal transferase activity was markedly elevated in all untreated acute lymphoblastic leukemia patients, whereas low levels which were difficult to interpret were present in the peripheral blood samples of two patients at diagnosis and six patients at relapse who had low absolute lymphoblast counts. Because of greater variation in the lymphoblast content of peripheral blood, bone marrow assays are more reliable in detecting disease activity. Marrow terminal deoxynucleotidyltransferase values obtained during the active phase of acute lymphoblastic leukemia were significantly greater than those found in other types of leukemia, bone marrow malignancies, and hematologic disorders. Terminal transferase determinations in blast cells of two patients with leukemic conversion of non-Hodgkins lymphoma and in tumor cells from one patient with Burkitts lymphoma were within the control range. These dat further define the usefulness of terminal deoxynucleotidyltrnasferase assay in the differentiation and classication of hematologic malignancies.

Terminal Deoxynucleotidyl Transferase Measurements in the Differential Diagnosis of Adult Leukaemias

Summary. Terminal deoxynucleotidyl transferase (TDT) is an unusual DNA polymerase that does not use template information to synthesize new strands of DNA. It is normally found in high concentration in thymus (50 u/108 cells) and in low concentration in bone marrow (< 5 u/108). We report TDT measurements in the marrow and/or peripheral blood of 51 adult patients, 28 of whom had leukaemia. TDT is present in very high levels (> 50 u/108 cells) in leukaemic lymphoblasts and in low levels in leukaemic myeloblasts (< 9 u/108 cells). Of two patients who developed lymphosarcoma‐cell leukaemia following treatment of poorly differentiated lymphocytic lymphoma, one had high and one low levels of TDT in the leukaemic blast cells. Leukaemic cells from three of seven patients with chronic myeloid leukaemia in blast crisis had TDT levels within the range expected of acute lymphoblastic rather than acute myeloid leukaemia. High TDT in leukaemic cells probably marks them as derivatives of lymphoid progenitor, thymic or pluripotential stem cells. Quantitative assay of TDT may provide information useful in classifying haematological neoplasms.