Deeba Kamil

Development of controlled release nanoformulations of carbendazim employing amphiphilic polymers and their bioefficacy evaluation against Rhizoctonia solani

Controlled release nanoformulations of carbendazim (Methyl 1H-benzimidazol-2-ylcarbamate), a systemic fungicide, have been prepared using laboratory synthesized poly(ethylene glycols) (PEGs)-based functionalized amphiphilic copolymers. The release kinetics of carbendazim from developed controlled release (CR) formulations was studied and compared with that of the commercially available 50% Wettable Powder (WP). Further, the bioefficacy evaluation of developed formulations was done against plant pathogenic fungi Rhizoctonia solani by the poison food technique method. The release of maximum amount of carbendazim from developed formulations was dependent on the molecular weight of PEGs and was found to increase with increasing molecular weights. The range of carbendazim release was found to be between 10th to 35th day as compared to commercial formulation which was up to 7th day. The diffusion exponent (n value) of carbendazim in water ranged from 0.37 to 0.52 in the tested formulations. The half-release (t1/2) values ranged between 9.47 and 24.20 days, and the period of optimum availability (POA) of carbendazim ranged from 9.15 to 26.63 days. Also, ED50 values of the developed formulations vary from 0.40 to 0.74 mg L−1. These formulations can be used to optimize the release of carbendazim to achieve disease control for the desired period depending on the matrix of the polymer used.

Bioefficacy of Trichoderma isolates against soil-borne pathogens

The study of morphology and bioefficacy of Trichoderma was undertaken to select the effective isolates against soil-borne pathogens. Fifty one (51) isolates (23 isolates of Trichoderma virens and 28 isolates of Trichoderma harzianum) were morphologically characterised based on the growth characteristics on PDA medium, the size and shape of phialides and conidia.These isolates were screened for bioefficacy against soil borne plant pathogens (Fusarium oxysporum, Rhizoctonia solani and Sclerotium rolfsii) based on their percent inhibition observed during dual culture, volatile and non-volatile methods. Eight T. virens isolates and 12 T. harzianum isolates were proven to be potential isolates against the soil-borne pathogens tested. No correlation was found between bioefficacy and morphology in both species isolates.

Development of Species Specific Markers for the identification of Trichoderma asperellum and Trichoderma harzianum

Many species of genus Trichoderma are bio-control fungi and commonly distributed in all the geographic regions of the world. Conventional methods are not always satisfactory to discriminate between differentTrichoderma species. Furthermore, culture techniques are labour intensive and require considerable taxonomic expertise. In contrast, molecular techniques such as PCR and DNA sequencing are very sensitive, reliable and rapid methods for species detection. Therefore, the conserved sequences from multiple alignments of target genes ie. Translation Elongation Factor (tef1) and ribosomal subunit (rpb2) were used to design the primers for detection of Trichoderma asperellum and Trichoderma harzianum, respectively. tef1 gene sequences from 13 isolates of Trichoderma asperellum and 14 sequences from 7 different species of Trichoderma were aligned and 688 base pairs conserved region of Trichoderma asperellum was taken for designing the species specific primer. The specific oligonucleotide primer (T2AF 5′- CTCTGCCGTTGACTGTGAACG - 3′ and T2AR 5′-CGATAGTGGGGTTGCCGTCAA - 3′) has been designed with 507 base pairs for the amplification of specific region of Trichoderma asperellum and validated against 50 isolates of seven different species of Trichoderma. The sequences of rpb2 gene from 11 isolates of Trichoderma harzianum and 12 sequences from 12 different species of Trichoderma were aligned and 857 base pairs conserved region of Trichoderma harzianum was taken for designing species specific primer. The speci f ic oligonucl e o t ide primer (Th1F 5′ - TTGCATGGGTTCGCTAAAGG - 3′ and Th1R 5′- TCTTGTCAGCATCATGGCCGT - 3′) has been designed with 824 base pairs for the amplification of specific region of Trichoderma harzianum and validated against 52 isolates of seven different species of Trichoderma. The above said newly designed molecular markers are able to identify Trichoderma asperellum and Trichoderma harzianum accurately with less time.

Molecular and Morphological Diversity of Rhizoctonia bataticola Causing Dry Root Rot Disease from India

Rhizoctonia bataticola (Taub.)Butl.a omnipresent soil-borne fungus having pycnidial state as Macrophomina phaseolina (Tassi.) Goid., causes dry root rot disease in a wide range of hosts starting from cereal crops to horticultural and medicinal crops. The present study was aimed to find out genetic and morphological variability among the twenty five indigenous isolates of R. bataticolacollected from geographically distinct regions (10 states) infecting 19 different crop plants. Sclerotial morphology of the isolates was studied and they were confirmed to species using species-specific primers. All the isolates were grouped into four different types of sclerotia. Genetic diversity of all these isolates was analysed using random amplified polymorphic DNA (RAPD) markers and inter simple sequence repeat (ISSR) markers. Ten random primers for RAPD and six primers for ISSR were tested for amplification of genomic DNA of R. bataticola isolates. Best six primers for RAPD and five primers for ISSR were further analysed. Unweighted pair-group method using arithmetic means (UPGMA) clustering of data showed that isolates did clearly differentiate to the specific group according to the geographical origins. ISSR markers were found more efficient than RAPD markers to correlate the genetic diversity with the grouping of isolates according to the geographical regions.But RAPD markers were found efficient todifferentiate R. bataticola isolates into different clusters according to their sclerotial morphology.It was the first study that investigated genetic relationships with two PCR-markers among different isolates of R. bataticola belongs to different hosts from India.

Combined Approach of Morphological and Molecular Diagnosis of Fusaria spp. Causing Diseases in Crop Plants

Fusarium species cause a huge range of diseases on an extraordinary range of host plants. Fusarium taxonomy has been plagued by changing species concepts, with as few as nine or well over 1,000 species being recognized by various taxonomists during the past 100 years, depending on the species concept employed. The possible outcome from morphological diagnosis alone may identify quickly when the number of species associated with particular host or disease symptoms is relatively limited. Morphological characters frequently are homoplastic, and the circumscription of taxa, based on the size and shape of conidia and conidiophores and the color and texture of colonies, has resulted in an underestimation of species diversity within Fusarium. Phylogenetic species recognition, based on DNA sequence data from multiple loci, allows greater numbers of species to be distinguished than in the exclusive use of morphological features. Closely related species may show considerable divergence in IGS, often reflecting both length and sequence variation; length and restriction site variation may even occur within the rDNA of an individual in some fungi.