N. Prabhakaran

Bioefficacy of Trichoderma isolates against soil-borne pathogens

The study of morphology and bioefficacy of Trichoderma was undertaken to select the effective isolates against soil-borne pathogens. Fifty one (51) isolates (23 isolates of Trichoderma virens and 28 isolates of Trichoderma harzianum) were morphologically characterised based on the growth characteristics on PDA medium, the size and shape of phialides and conidia.These isolates were screened for bioefficacy against soil borne plant pathogens (Fusarium oxysporum, Rhizoctonia solani and Sclerotium rolfsii) based on their percent inhibition observed during dual culture, volatile and non-volatile methods. Eight T. virens isolates and 12 T. harzianum isolates were proven to be potential isolates against the soil-borne pathogens tested. No correlation was found between bioefficacy and morphology in both species isolates.

Development of Species Specific Markers for the identification of Trichoderma asperellum and Trichoderma harzianum

Many species of genus Trichoderma are bio-control fungi and commonly distributed in all the geographic regions of the world. Conventional methods are not always satisfactory to discriminate between differentTrichoderma species. Furthermore, culture techniques are labour intensive and require considerable taxonomic expertise. In contrast, molecular techniques such as PCR and DNA sequencing are very sensitive, reliable and rapid methods for species detection. Therefore, the conserved sequences from multiple alignments of target genes ie. Translation Elongation Factor (tef1) and ribosomal subunit (rpb2) were used to design the primers for detection of Trichoderma asperellum and Trichoderma harzianum, respectively. tef1 gene sequences from 13 isolates of Trichoderma asperellum and 14 sequences from 7 different species of Trichoderma were aligned and 688 base pairs conserved region of Trichoderma asperellum was taken for designing the species specific primer. The specific oligonucleotide primer (T2AF 5′- CTCTGCCGTTGACTGTGAACG - 3′ and T2AR 5′-CGATAGTGGGGTTGCCGTCAA - 3′) has been designed with 507 base pairs for the amplification of specific region of Trichoderma asperellum and validated against 50 isolates of seven different species of Trichoderma. The sequences of rpb2 gene from 11 isolates of Trichoderma harzianum and 12 sequences from 12 different species of Trichoderma were aligned and 857 base pairs conserved region of Trichoderma harzianum was taken for designing species specific primer. The speci f ic oligonucl e o t ide primer (Th1F 5′ - TTGCATGGGTTCGCTAAAGG - 3′ and Th1R 5′- TCTTGTCAGCATCATGGCCGT - 3′) has been designed with 824 base pairs for the amplification of specific region of Trichoderma harzianum and validated against 52 isolates of seven different species of Trichoderma. The above said newly designed molecular markers are able to identify Trichoderma asperellum and Trichoderma harzianum accurately with less time.

Molecular and Morphological Diversity of Rhizoctonia bataticola Causing Dry Root Rot Disease from India

Rhizoctonia bataticola (Taub.)Butl.a omnipresent soil-borne fungus having pycnidial state as Macrophomina phaseolina (Tassi.) Goid., causes dry root rot disease in a wide range of hosts starting from cereal crops to horticultural and medicinal crops. The present study was aimed to find out genetic and morphological variability among the twenty five indigenous isolates of R. bataticolacollected from geographically distinct regions (10 states) infecting 19 different crop plants. Sclerotial morphology of the isolates was studied and they were confirmed to species using species-specific primers. All the isolates were grouped into four different types of sclerotia. Genetic diversity of all these isolates was analysed using random amplified polymorphic DNA (RAPD) markers and inter simple sequence repeat (ISSR) markers. Ten random primers for RAPD and six primers for ISSR were tested for amplification of genomic DNA of R. bataticola isolates. Best six primers for RAPD and five primers for ISSR were further analysed. Unweighted pair-group method using arithmetic means (UPGMA) clustering of data showed that isolates did clearly differentiate to the specific group according to the geographical origins. ISSR markers were found more efficient than RAPD markers to correlate the genetic diversity with the grouping of isolates according to the geographical regions.But RAPD markers were found efficient todifferentiate R. bataticola isolates into different clusters according to their sclerotial morphology.It was the first study that investigated genetic relationships with two PCR-markers among different isolates of R. bataticola belongs to different hosts from India.